Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722504993:

Variant ID: vg0722504993 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22504993
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TATAAATGCAAGATTAGTATAGAATTAAGATGGAATAGACAGATACCATTGTGGTGTCCCTTAAGGGCCTGTTTGGCACAGCTCCAGCTCCAGCTCCACC[C/T]
CTCCTGGAGCTGGAGCTCAGCCAAACAGTTTCAGCTCCACCAAAACTGGGAGTGGAGCTCTCTCACAAAATGAACTAGAGTTGTGGAGCTGGGTTTAGGC

Reverse complement sequence

GCCTAAACCCAGCTCCACAACTCTAGTTCATTTTGTGAGAGAGCTCCACTCCCAGTTTTGGTGGAGCTGAAACTGTTTGGCTGAGCTCCAGCTCCAGGAG[G/A]
GGTGGAGCTGGAGCTGGAGCTGTGCCAAACAGGCCCTTAAGGGACACCACAATGGTATCTGTCTATTCCATCTTAATTCTATACTAATCTTGCATTTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 19.70% 0.04% 0.00% NA
All Indica  2759 83.80% 16.10% 0.04% 0.00% NA
All Japonica  1512 83.90% 16.10% 0.00% 0.00% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 78.30% 21.70% 0.00% 0.00% NA
Indica III  913 82.80% 17.10% 0.11% 0.00% NA
Indica Intermediate  786 77.10% 22.90% 0.00% 0.00% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 60.50% 39.50% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722504993 C -> T LOC_Os07g37570.1 upstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:93.548; most accessible tissue: Minghui63 flag leaf, score: 98.83 N N N N
vg0722504993 C -> T LOC_Os07g37560-LOC_Os07g37570 intergenic_region ; MODIFIER silent_mutation Average:93.548; most accessible tissue: Minghui63 flag leaf, score: 98.83 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722504993 C T -0.02 -0.03 -0.02 -0.03 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722504993 9.35E-06 9.35E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 8.08E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 5.40E-06 mr1209 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 3.77E-07 mr1222 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 7.24E-06 7.24E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 3.75E-06 7.30E-07 mr1372 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 3.81E-06 5.34E-08 mr1376 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 7.46E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 3.81E-06 5.34E-08 mr1431 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 1.39E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 8.86E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 1.57E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 9.63E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 9.19E-06 mr1737 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 2.16E-06 mr1820 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 2.15E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 7.29E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722504993 NA 8.40E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251