| Variant ID: vg0722154115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 22154115 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.01, others allele: 0.00, population size: 213. )
CACTTAAAGACCAGCCTATGGCACCATTTTAACACTTAGTTTACTATGGGCACACCTACAAAGGATTGCATTAGTATGCCACTTAACTCAACCATATGCA[A/T]
ATGCCTGCGATATTTACGATGGCATAGTAAACACTACACCCTGCATTGAAAGGACAGGGATGGACAAAAAGGAGGAGGTGATGAAAATAGTTATATTTTT
AAAAATATAACTATTTTCATCACCTCCTCCTTTTTGTCCATCCCTGTCCTTTCAATGCAGGGTGTAGTGTTTACTATGCCATCGTAAATATCGCAGGCAT[T/A]
TGCATATGGTTGAGTTAAGTGGCATACTAATGCAATCCTTTGTAGGTGTGCCCATAGTAAACTAAGTGTTAAAATGGTGCCATAGGCTGGTCTTTAAGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 32.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 10.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 26.30% | 73.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.20% | 13.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.90% | 12.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 51.20% | 48.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.20% | 61.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 48.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0722154115 | A -> T | LOC_Os07g36980-LOC_Os07g36990 | intergenic_region ; MODIFIER | silent_mutation | Average:46.914; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0722154115 | NA | 3.29E-17 | Grain_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0722154115 | NA | 8.69E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 1.66E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 4.35E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 7.58E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 7.47E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 9.99E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 4.12E-11 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 3.17E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0722154115 | NA | 2.22E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/