Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722086783:

Variant ID: vg0722086783 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22086783
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TATACTTATCAGCTAAAATTTTAATTTTCAACATTAAATTTAAAGCTAATTATAGGGTTTTTTCATTGAAGCCTATTTTTTAGCCTTTGCTTTTAGATTA[T/C]
TAAGAATACGTATATAAAAGTTTTATTACAAATTACTTTTCGTTTACAAATATGCTGTCTAGCTTGTTCCTTGAATAAGCGAAACAATGGAGCCGTTACT

Reverse complement sequence

AGTAACGGCTCCATTGTTTCGCTTATTCAAGGAACAAGCTAGACAGCATATTTGTAAACGAAAAGTAATTTGTAATAAAACTTTTATATACGTATTCTTA[A/G]
TAATCTAAAAGCAAAGGCTAAAAAATAGGCTTCAATGAAAAAACCCTATAATTAGCTTTAAATTTAATGTTGAAAATTAAAATTTTAGCTGATAAGTATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	32.50%	0.04%	0.00%	NA
All Indica	2759	89.90%	10.10%	0.04%	0.00%	NA
All Japonica	1512	25.80%	74.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	86.00%	13.80%	0.22%	0.00%	NA
Indica III	913	88.10%	11.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.00%	12.00%	0.00%	0.00%	NA
Temperate Japonica	767	6.30%	93.70%	0.00%	0.00%	NA
Tropical Japonica	504	50.40%	49.60%	0.00%	0.00%	NA
Japonica Intermediate	241	36.50%	63.10%	0.41%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722086783	T -> C	LOC_Os07g36880.1	upstream_gene_variant ; 1217.0bp to feature; MODIFIER	silent_mutation	Average:62.723; most accessible tissue: Callus, score: 93.981	N	N	N	N
vg0722086783	T -> C	LOC_Os07g36870.1	downstream_gene_variant ; 325.0bp to feature; MODIFIER	silent_mutation	Average:62.723; most accessible tissue: Callus, score: 93.981	N	N	N	N
vg0722086783	T -> C	LOC_Os07g36890.1	downstream_gene_variant ; 4141.0bp to feature; MODIFIER	silent_mutation	Average:62.723; most accessible tissue: Callus, score: 93.981	N	N	N	N
vg0722086783	T -> C	LOC_Os07g36870-LOC_Os07g36880	intergenic_region ; MODIFIER	silent_mutation	Average:62.723; most accessible tissue: Callus, score: 93.981	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722086783	NA	1.71E-19	Grain_length	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722086783	NA	7.94E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	1.73E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	1.31E-11	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	2.06E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	6.82E-08	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	1.46E-07	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	3.14E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	3.15E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	1.36E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	6.08E-07	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	1.57E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	4.08E-12	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	2.16E-10	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	5.56E-08	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722086783	NA	6.08E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251