Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722002330:

Variant ID: vg0722002330 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 22002330
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

AATATCTCAGATTCTCTGTAAGGACTCCTCTGGTTGAGTAATATATCTTTGCTCTTCCCCTCAAAAAAAAACAAACGAACTTAAAATTTGACTCATACAC[G/A]
GAATTATATTTTCAAAAGCTAACGAACTAAAAAACCAACTCAAACACGGATGAGACGTACCAAAATACCGGCAAAAACTTCTTCAACTTTTATAATAGTA

Reverse complement sequence

TACTATTATAAAAGTTGAAGAAGTTTTTGCCGGTATTTTGGTACGTCTCATCCGTGTTTGAGTTGGTTTTTTAGTTCGTTAGCTTTTGAAAATATAATTC[C/T]
GTGTATGAGTCAAATTTTAAGTTCGTTTGTTTTTTTTTGAGGGGAAGAGCAAAGATATATTACTCAACCAGAGGAGTCCTTACAGAGAATCTGAGATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	36.00%	0.02%	0.00%	NA
All Indica	2759	55.60%	44.30%	0.04%	0.00%	NA
All Japonica	1512	82.10%	17.90%	0.00%	0.00%	NA
Aus	269	30.50%	69.50%	0.00%	0.00%	NA
Indica I	595	85.40%	14.60%	0.00%	0.00%	NA
Indica II	465	53.80%	46.20%	0.00%	0.00%	NA
Indica III	913	38.80%	61.10%	0.11%	0.00%	NA
Indica Intermediate	786	53.80%	46.20%	0.00%	0.00%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	67.70%	32.30%	0.00%	0.00%	NA
Japonica Intermediate	241	71.00%	29.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0722002330	G -> A	LOC_Os07g36720.1	downstream_gene_variant ; 64.0bp to feature; MODIFIER	silent_mutation	Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0722002330	G -> A	LOC_Os07g36730.1	downstream_gene_variant ; 706.0bp to feature; MODIFIER	silent_mutation	Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0722002330	G -> A	LOC_Os07g36740.1	downstream_gene_variant ; 3732.0bp to feature; MODIFIER	silent_mutation	Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0722002330	G -> A	LOC_Os07g36720-LOC_Os07g36730	intergenic_region ; MODIFIER	silent_mutation	Average:31.081; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0722002330	NA	1.71E-06	Grain_weight	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722002330	7.75E-06	NA	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	1.90E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	6.37E-08	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	7.67E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	2.37E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	4.00E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	1.86E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	9.71E-06	NA	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	4.66E-06	1.51E-06	mr1520	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	5.16E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722002330	NA	1.54E-07	mr1654	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251