Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721707193:

Variant ID: vg0721707193 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21707193
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

CACATTGTGAAACGAAGGAAGTAGAATTTACGATTTGTGAGAATTTTATTTCAAATAATATATACTTTCTTCGTCCCAAAAAAAATTAAACTCTATAGAT[G/A]
AATATGGATATATGTGTGTGTGTGATGTGTTCATATTTATCCGTAGAGTTTAATTCTTTTAGGGACAGAGGAGCAGACAGGAGTCGCTTTTTTGTTATGT

Reverse complement sequence

ACATAACAAAAAAGCGACTCCTGTCTGCTCCTCTGTCCCTAAAAGAATTAAACTCTACGGATAAATATGAACACATCACACACACACATATATCCATATT[C/T]
ATCTATAGAGTTTAATTTTTTTTGGGACGAAGAAAGTATATATTATTTGAAATAAAATTCTCACAAATCGTAAATTCTACTTCCTTCGTTTCACAATGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.10%	6.30%	4.06%	48.48%	NA
All Indica	2759	21.70%	0.90%	2.54%	74.85%	NA
All Japonica	1512	71.40%	16.30%	7.21%	5.09%	NA
Aus	269	52.40%	0.00%	0.74%	46.84%	NA
Indica I	595	11.10%	0.00%	1.68%	87.23%	NA
Indica II	465	13.10%	2.20%	0.65%	84.09%	NA
Indica III	913	31.80%	0.50%	4.05%	63.64%	NA
Indica Intermediate	786	23.00%	1.40%	2.54%	73.03%	NA
Temperate Japonica	767	82.10%	0.40%	7.82%	9.65%	NA
Tropical Japonica	504	55.00%	40.30%	4.76%	0.00%	NA
Japonica Intermediate	241	71.80%	16.60%	10.37%	1.24%	NA
VI/Aromatic	96	78.10%	18.80%	2.08%	1.04%	NA
Intermediate	90	54.40%	11.10%	10.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721707193	G -> DEL	N	N	silent_mutation	Average:72.835; most accessible tissue: Callus, score: 97.794	N	N	N	N
vg0721707193	G -> A	LOC_Os07g36300.1	upstream_gene_variant ; 443.0bp to feature; MODIFIER	silent_mutation	Average:72.835; most accessible tissue: Callus, score: 97.794	N	N	N	N
vg0721707193	G -> A	LOC_Os07g36290.1	downstream_gene_variant ; 1526.0bp to feature; MODIFIER	silent_mutation	Average:72.835; most accessible tissue: Callus, score: 97.794	N	N	N	N
vg0721707193	G -> A	LOC_Os07g36290-LOC_Os07g36300	intergenic_region ; MODIFIER	silent_mutation	Average:72.835; most accessible tissue: Callus, score: 97.794	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721707193	NA	4.94E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	3.94E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	1.12E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	4.20E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	1.02E-07	1.84E-06	mr1155_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	1.06E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	9.67E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	1.69E-06	NA	mr1408_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	3.19E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	5.33E-09	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	7.10E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721707193	NA	6.44E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251