Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0721439672:

Variant ID: vg0721439672 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 21439672
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCGACACCAATGTTGGTGGTGCCGTTCTCCTTCACATTAGTGACTTAGCTTTCACCCGAGGGTGGAGAGGACGGCGCCAACGTCCTTGGTGCTGTCAT[G/A]
TTGGACCACGGCACCAACTACATTGGCGCCGCGAAAAGCACCATTTCTAAAATAAGTTATTTTAAGGATTTATTTGTAGAATAAGTTTTTTTTCAAAAGA

Reverse complement sequence

TCTTTTGAAAAAAAACTTATTCTACAAATAAATCCTTAAAATAACTTATTTTAGAAATGGTGCTTTTCGCGGCGCCAATGTAGTTGGTGCCGTGGTCCAA[C/T]
ATGACAGCACCAAGGACGTTGGCGCCGTCCTCTCCACCCTCGGGTGAAAGCTAAGTCACTAATGTGAAGGAGAACGGCACCACCAACATTGGTGTCGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	37.00%	0.02%	0.00%	NA
All Indica	2759	78.90%	21.10%	0.04%	0.00%	NA
All Japonica	1512	28.20%	71.80%	0.00%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	84.00%	16.00%	0.00%	0.00%	NA
Indica II	465	87.10%	12.90%	0.00%	0.00%	NA
Indica III	913	80.30%	19.60%	0.11%	0.00%	NA
Indica Intermediate	786	68.40%	31.60%	0.00%	0.00%	NA
Temperate Japonica	767	42.80%	57.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.30%	93.70%	0.00%	0.00%	NA
Japonica Intermediate	241	27.40%	72.60%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	33.30%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0721439672	G -> A	LOC_Os07g35790.1	upstream_gene_variant ; 2001.0bp to feature; MODIFIER	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0721439672	G -> A	LOC_Os07g35810.1	downstream_gene_variant ; 1365.0bp to feature; MODIFIER	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0721439672	G -> A	LOC_Os07g35800.1	intron_variant ; MODIFIER	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0721439672	NA	2.94E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	NA	2.47E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	NA	2.16E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	NA	2.98E-07	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	8.58E-06	NA	mr1531_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	NA	2.10E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	NA	1.57E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0721439672	NA	7.19E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251