Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720805926:

Variant ID: vg0720805926 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20805926
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATATTACCTCAGTCGTAAAATATAGCTATTTTTAGTACAATACTTTATCTAAACTGAAACTATTTCTTCACTTATCTTCTTCTCTTAACCAATTACAA[C/T]
CATTCTTTTTTATCTACTTTCTCTTCTCAACCAATCACATACTTCCTCTAATCATTTTTATATTTTTTTAACCCATATTAACCTAAAAAAATACTTACAT

Reverse complement sequence

ATGTAAGTATTTTTTTAGGTTAATATGGGTTAAAAAAATATAAAAATGATTAGAGGAAGTATGTGATTGGTTGAGAAGAGAAAGTAGATAAAAAAGAATG[G/A]
TTGTAATTGGTTAAGAGAAGAAGATAAGTGAAGAAATAGTTTCAGTTTAGATAAAGTATTGTACTAAAAATAGCTATATTTTACGACTGAGGTAATATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.00%	1.30%	1.31%	0.40%	NA
All Indica	2759	99.60%	0.00%	0.40%	0.00%	NA
All Japonica	1512	91.80%	3.70%	3.24%	1.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.10%	1.02%	0.00%	NA
Temperate Japonica	767	94.70%	1.70%	3.65%	0.00%	NA
Tropical Japonica	504	93.80%	1.00%	1.39%	3.77%	NA
Japonica Intermediate	241	78.40%	15.80%	5.81%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720805926	C -> DEL	N	N	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N
vg0720805926	C -> T	LOC_Os07g34720.1	upstream_gene_variant ; 728.0bp to feature; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N
vg0720805926	C -> T	LOC_Os07g34710.1	downstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N
vg0720805926	C -> T	LOC_Os07g34730.1	downstream_gene_variant ; 2107.0bp to feature; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N
vg0720805926	C -> T	LOC_Os07g34710.3	downstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N
vg0720805926	C -> T	LOC_Os07g34710.2	downstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N
vg0720805926	C -> T	LOC_Os07g34710-LOC_Os07g34720	intergenic_region ; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Callus, score: 98.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720805926	1.05E-11	1.64E-11	mr1679	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	1.31E-09	1.77E-11	mr1691	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	3.53E-12	5.90E-16	mr1693	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	4.58E-09	3.71E-09	mr1720	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	NA	5.46E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	NA	1.60E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	1.48E-08	8.02E-08	mr1679_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	1.31E-08	2.10E-11	mr1691_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720805926	1.13E-08	2.78E-10	mr1720_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251