Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720751948:

Variant ID: vg0720751948 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 20751948
Reference Allele: TAlternative Allele: A,TA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCACATACCGTGCATTCCATGGCTGTGTTGGGGAGGTGAGTTCGCACGCAAAACGGAGCGACACATTTTCTTATGATTAATTAAGTATTTACTATTTTTT[T/A,TA]
AAAAAATGGATTAACATAATTTTCTAAAGCAACTTTTGCATAATTTTTTTTTTAAAAAATACCATTTAATAGTTTGAAAAACGTGCGCGTGAGTTGGGAA

Reverse complement sequence

TTCCCAACTCACGCGCACGTTTTTCAAACTATTAAATGGTATTTTTTAAAAAAAAAATTATGCAAAAGTTGCTTTAGAAAATTATGTTAATCCATTTTTT[A/T,TA]
AAAAAATAGTAAATACTTAATTAATCATAAGAAAATGTGTCGCTCCGTTTTGCGTGCGAACTCACCTCCCCAACACAGCCATGGAATGCACGGTATGTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 21.30% 3.49% 0.00% TA: 0.42%
All Indica  2759 80.90% 12.70% 5.69% 0.00% TA: 0.72%
All Japonica  1512 59.10% 40.50% 0.33% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 70.60% 12.80% 16.64% 0.00% NA
Indica II  465 94.80% 3.40% 1.72% 0.00% NA
Indica III  913 75.20% 22.30% 0.22% 0.00% TA: 2.19%
Indica Intermediate  786 86.90% 7.00% 6.11% 0.00% NA
Temperate Japonica  767 33.80% 65.70% 0.52% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 72.60% 27.00% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720751948 T -> TA LOC_Os07g34598.1 upstream_gene_variant ; 2488.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> TA LOC_Os07g34598.2 upstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> TA LOC_Os07g34610.1 downstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> TA LOC_Os07g34620.1 downstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> TA LOC_Os07g34610.2 downstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> TA LOC_Os07g34610-LOC_Os07g34620 intergenic_region ; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> A LOC_Os07g34598.1 upstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> A LOC_Os07g34598.2 upstream_gene_variant ; 2490.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> A LOC_Os07g34610.1 downstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> A LOC_Os07g34620.1 downstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> A LOC_Os07g34610.2 downstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N
vg0720751948 T -> A LOC_Os07g34610-LOC_Os07g34620 intergenic_region ; MODIFIER silent_mutation Average:87.033; most accessible tissue: Callus, score: 95.455 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0720751948 T A 0.0 0.0 0.01 0.0 0.0 0.0
vg0720751948 T TA -0.09 -0.05 -0.08 -0.04 -0.07 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720751948 NA 1.71E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720751948 NA 8.15E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720751948 NA 2.37E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720751948 NA 1.58E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720751948 NA 2.75E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720751948 2.59E-06 NA mr1781_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251