Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720575452:

Variant ID: vg0720575452 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20575452
Reference Allele: T	Alternative Allele: A,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACGCTACCATTATACTTCTCTACGGCCCATCCAATGCCTCTTCTCTTTGTTGTCATTGGGATTTTAAAAACGAATATAATTATCTTTTGGGCTCATTTT[T/A,G]
TATTTTCTATAAGTCCCGCCAAACCATCAGCGGCTTTGTCACTGTACCGCTCTACGCTCACCCGCTGCCTCCCTTGTTTATTACATTGAGATTTTAAAAT

Reverse complement sequence

ATTTTAAAATCTCAATGTAATAAACAAGGGAGGCAGCGGGTGAGCGTAGAGCGGTACAGTGACAAAGCCGCTGATGGTTTGGCGGGACTTATAGAAAATA[A/T,C]
AAAATGAGCCCAAAAGATAATTATATTCGTTTTTAAAATCCCAATGACAACAAAGAGAAGAGGCATTGGATGGGCCGTAGAGAAGTATAATGGTAGCGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	47.20%	0.40%	0.28%	G: 0.11%
All Indica	2759	24.20%	75.60%	0.18%	0.00%	G: 0.07%
All Japonica	1512	97.00%	1.10%	0.93%	0.79%	G: 0.20%
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	15.00%	85.00%	0.00%	0.00%	NA
Indica II	465	8.40%	91.60%	0.00%	0.00%	NA
Indica III	913	34.20%	65.80%	0.00%	0.00%	NA
Indica Intermediate	786	28.90%	70.20%	0.64%	0.00%	G: 0.25%
Temperate Japonica	767	95.60%	0.70%	1.83%	1.56%	G: 0.39%
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720575452	T -> DEL	N	N	silent_mutation	Average:32.856; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0720575452	T -> G	LOC_Os07g34330.1	downstream_gene_variant ; 3892.0bp to feature; MODIFIER	silent_mutation	Average:32.856; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0720575452	T -> G	LOC_Os07g34330-LOC_Os07g34340	intergenic_region ; MODIFIER	silent_mutation	Average:32.856; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0720575452	T -> A	LOC_Os07g34330.1	downstream_gene_variant ; 3892.0bp to feature; MODIFIER	silent_mutation	Average:32.856; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0720575452	T -> A	LOC_Os07g34330-LOC_Os07g34340	intergenic_region ; MODIFIER	silent_mutation	Average:32.856; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720575452	NA	3.04E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	2.30E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	3.62E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	4.14E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	2.77E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	4.52E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	9.29E-07	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	3.95E-06	NA	mr1679_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720575452	NA	2.62E-17	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251