Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720401570:

Variant ID: vg0720401570 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20401570
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGCTCACTATTTATTATAAATTTATTGGGGCATTTGTAAATTTGCCATTGATTTTTTTCAATATTGCAAGGATGTCATTCGAATGATAGTTCTAGTGG[T/C]
ATTTTTGTAATTTTCTAGTATCAGTTTTGCAATAACGATTCAAATTAGTGGTAAATTTGCAATTGCCCCAAATTTATTATAGAGCTAACGTGTATAATTG

Reverse complement sequence

CAATTATACACGTTAGCTCTATAATAAATTTGGGGCAATTGCAAATTTACCACTAATTTGAATCGTTATTGCAAAACTGATACTAGAAAATTACAAAAAT[A/G]
CCACTAGAACTATCATTCGAATGACATCCTTGCAATATTGAAAAAAATCAATGGCAAATTTACAAATGCCCCAATAAATTTATAATAAATAGTGAGCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 14.20% 0.06% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 59.30% 40.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 30.50% 69.50% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720401570 T -> C LOC_Os07g34120.1 downstream_gene_variant ; 2818.0bp to feature; MODIFIER silent_mutation Average:56.494; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0720401570 T -> C LOC_Os07g34110-LOC_Os07g34120 intergenic_region ; MODIFIER silent_mutation Average:56.494; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720401570 NA 6.43E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720401570 NA 7.92E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720401570 NA 1.10E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720401570 NA 2.59E-15 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0720401570 3.25E-06 NA mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 2.33E-08 NA mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 6.56E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 5.99E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 3.42E-07 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 1.06E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 2.89E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 1.18E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 5.47E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720401570 NA 1.06E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251