Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720317869:

Variant ID: vg0720317869 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 20317869
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAATCTCCCACCTTGCAAAATCAACATCAATATTGATGTCAACATGCATTTTCATAGGAGGATATATATGGATACTAACTACTCCCTAATTAAGCTCA[G/A]
AATTATAAGGGCTTACGCCATCACGCGAGGTGCTCATATGAACCAATAATAAAATGAATATCATCTGTTTAATTATAAGGAGCTAGTACTGTAACAAAAC

Reverse complement sequence

GTTTTGTTACAGTACTAGCTCCTTATAATTAAACAGATGATATTCATTTTATTATTGGTTCATATGAGCACCTCGCGTGATGGCGTAAGCCCTTATAATT[C/T]
TGAGCTTAATTAGGGAGTAGTTAGTATCCATATATATCCTCCTATGAAAATGCATGTTGACATCAATATTGATGTTGATTTTGCAAGGTGGGAGATTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 12.60% 8.55% 35.48% NA
All Indica  2759 22.90% 16.90% 13.41% 46.79% NA
All Japonica  1512 74.30% 5.70% 1.19% 18.85% NA
Aus  269 97.00% 0.70% 0.37% 1.86% NA
Indica I  595 13.10% 12.40% 26.72% 47.73% NA
Indica II  465 5.40% 22.80% 17.63% 54.19% NA
Indica III  913 30.70% 18.10% 3.29% 47.97% NA
Indica Intermediate  786 31.60% 15.50% 12.60% 40.33% NA
Temperate Japonica  767 94.90% 0.10% 0.78% 4.17% NA
Tropical Japonica  504 44.80% 15.10% 1.79% 38.29% NA
Japonica Intermediate  241 70.10% 3.70% 1.24% 24.90% NA
VI/Aromatic  96 5.20% 26.00% 8.33% 60.42% NA
Intermediate  90 34.40% 15.60% 7.78% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0720317869 G -> DEL N N silent_mutation Average:79.897; most accessible tissue: Minghui63 young leaf, score: 97.0 N N N N
vg0720317869 G -> A LOC_Os07g34006.1 upstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:79.897; most accessible tissue: Minghui63 young leaf, score: 97.0 N N N N
vg0720317869 G -> A LOC_Os07g34006-LOC_Os07g34020 intergenic_region ; MODIFIER silent_mutation Average:79.897; most accessible tissue: Minghui63 young leaf, score: 97.0 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0720317869 G A -0.02 -0.02 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0720317869 NA 4.79E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720317869 NA 1.62E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720317869 NA 6.42E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720317869 NA 3.36E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720317869 7.58E-06 1.51E-15 mr1364_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720317869 NA 1.65E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720317869 NA 1.73E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251