| Variant ID: vg0720103928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20103928 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACATTTGCTAATGATGTATTAATTAGGTTTAATAAATTCGTCTCGCAGTTTCATGGCAAAATTTGTAATTTATTTTGTTATTAGAATACATTTAATACTT[T/C]
AAATGTGTGTCCGTATATCCAATGTGATATGCATGGGCAAAATTTTTGCCACCAAAACAGGCCCTAATCACAACAGAAATAGGAGTACATAGCATTTACA
TGTAAATGCTATGTACTCCTATTTCTGTTGTGATTAGGGCCTGTTTTGGTGGCAAAAATTTTGCCCATGCATATCACATTGGATATACGGACACACATTT[A/G]
AAGTATTAAATGTATTCTAATAACAAAATAAATTACAAATTTTGCCATGAAACTGCGAGACGAATTTATTAAACCTAATTAATACATCATTAGCAAATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 33.60% | 2.18% | 6.03% | NA |
| All Indica | 2759 | 70.20% | 16.30% | 3.30% | 10.18% | NA |
| All Japonica | 1512 | 26.00% | 73.50% | 0.40% | 0.13% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 1.70% | 3.70% | 5.04% | NA |
| Indica II | 465 | 68.40% | 5.80% | 5.59% | 20.22% | NA |
| Indica III | 913 | 57.00% | 33.40% | 1.75% | 7.89% | NA |
| Indica Intermediate | 786 | 72.10% | 13.60% | 3.44% | 10.81% | NA |
| Temperate Japonica | 767 | 5.90% | 93.90% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 54.20% | 45.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 31.10% | 67.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 27.80% | 6.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720103928 | T -> DEL | N | N | silent_mutation | Average:62.449; most accessible tissue: Callus, score: 90.842 | N | N | N | N |
| vg0720103928 | T -> C | LOC_Os07g33650.1 | upstream_gene_variant ; 2884.0bp to feature; MODIFIER | silent_mutation | Average:62.449; most accessible tissue: Callus, score: 90.842 | N | N | N | N |
| vg0720103928 | T -> C | LOC_Os07g33650.3 | upstream_gene_variant ; 2879.0bp to feature; MODIFIER | silent_mutation | Average:62.449; most accessible tissue: Callus, score: 90.842 | N | N | N | N |
| vg0720103928 | T -> C | LOC_Os07g33650.2 | upstream_gene_variant ; 2884.0bp to feature; MODIFIER | silent_mutation | Average:62.449; most accessible tissue: Callus, score: 90.842 | N | N | N | N |
| vg0720103928 | T -> C | LOC_Os07g33640-LOC_Os07g33650 | intergenic_region ; MODIFIER | silent_mutation | Average:62.449; most accessible tissue: Callus, score: 90.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720103928 | NA | 9.93E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 8.27E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 7.07E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 1.02E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 7.01E-35 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 5.79E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 3.15E-31 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 1.77E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 8.36E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | 4.79E-06 | 3.10E-09 | mr1364_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720103928 | NA | 3.24E-11 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |