Search for Variation information by Variation ID:
Detailed information for vg0720057093:
| Variant ID: vg0720057093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 20057093 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )
Flanking Sequence (100 bp) in Reference Genome:
TGCTGGACAGCATAGGATATATCTGGCCTGGTGAAAGTGAGATATTGTAATGCACCAGCGAGGCTCCTGTAATCAGTCAGGTCAGCAACTGGGGCACCAT[C/T]
GACAGCTGAGAGCTTGGCATTAGTGTCGACCGGCGTAGAACATGGCTTGCACTCGGACATGCCAGCACGAGCAAGAACATCAAGAATGTACTGTTGCTGG
Reverse complement sequence
CCAGCAACAGTACATTCTTGATGTTCTTGCTCGTGCTGGCATGTCCGAGTGCAAGCCATGTTCTACGCCGGTCGACACTAATGCCAAGCTCTCAGCTGTC[G/A]
ATGGTGCCCCAGTTGCTGACCTGACTGATTACAGGAGCCTCGCTGGTGCATTACAATATCTCACTTTCACCAGGCCAGATATATCCTATGCTGTCCAGCA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 11.70% | 2.84% | 27.82% | NA |
| All Indica | 2759 | 28.90% | 19.80% | 4.68% | 46.68% | NA |
| All Japonica | 1512 | 99.30% | 0.20% | 0.00% | 0.46% | NA |
| Aus | 269 | 97.40% | 0.40% | 0.00% | 2.23% | NA |
| Indica I | 595 | 12.40% | 39.20% | 4.03% | 44.37% | NA |
| Indica II | 465 | 26.00% | 21.50% | 6.02% | 46.45% | NA |
| Indica III | 913 | 35.90% | 8.30% | 3.94% | 51.81% | NA |
| Indica Intermediate | 786 | 34.70% | 17.40% | 5.22% | 42.62% | NA |
| Temperate Japonica | 767 | 99.00% | 0.30% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 2.20% | 4.44% | 15.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0720057093 | C -> DEL | LOC_Os07g33570.1 | N | frameshift_variant | Average:36.311; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0720057093 | C -> T | LOC_Os07g33570.1 | missense_variant ; p.Asp697Asn; MODERATE | nonsynonymous_codon ; D697N | Average:36.311; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | benign  |
1.021 |
DELETERIOUS | 0.03 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0720057093 | 3.31E-08 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | 1.54E-08 | 1.39E-12 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | 7.73E-06 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | 3.76E-06 | 1.54E-08 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | NA | 1.40E-07 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | NA | 1.16E-06 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | 4.57E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | 1.29E-06 | 6.34E-12 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0720057093 | NA | 7.95E-08 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |