Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720034658:

Variant ID: vg0720034658 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 20034658
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAAAAAAATGTGGAATGGCGCATAATATTATAATGCGATTATAAAAATAGATGCCTAAGAGGTTCCTTTTCTTTTCTTTTTACTAAAAGAGGATCTAC[G/A]
GTATGCCACTAGGTAAACTAGATGAAACCTGACGCGTTGTTGCGTGAGTTTTATAGGATAATAGTACAAATAACATGCAGATAGCTACACGGTATAACTT

Reverse complement sequence

AAGTTATACCGTGTAGCTATCTGCATGTTATTTGTACTATTATCCTATAAAACTCACGCAACAACGCGTCAGGTTTCATCTAGTTTACCTAGTGGCATAC[C/T]
GTAGATCCTCTTTTAGTAAAAAGAAAAGAAAAGGAACCTCTTAGGCATCTATTTTTATAATCGCATTATAATATTATGCGCCATTCCACATTTTTTTACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	15.50%	0.40%	42.47%	NA
All Indica	2759	18.90%	9.20%	0.65%	71.29%	NA
All Japonica	1512	75.50%	23.80%	0.07%	0.60%	NA
Aus	269	97.40%	0.00%	0.00%	2.60%	NA
Indica I	595	2.50%	9.70%	0.50%	87.23%	NA
Indica II	465	6.50%	15.50%	1.29%	76.77%	NA
Indica III	913	35.20%	3.00%	0.00%	61.88%	NA
Indica Intermediate	786	19.70%	12.20%	1.15%	66.92%	NA
Temperate Japonica	767	96.60%	2.30%	0.13%	0.91%	NA
Tropical Japonica	504	43.70%	56.30%	0.00%	0.00%	NA
Japonica Intermediate	241	75.10%	24.10%	0.00%	0.83%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	40.00%	33.30%	0.00%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720034658	G -> DEL	N	N	silent_mutation	Average:10.384; most accessible tissue: Callus, score: 46.0	N	N	N	N
vg0720034658	G -> A	LOC_Os07g33530.1	upstream_gene_variant ; 1924.0bp to feature; MODIFIER	silent_mutation	Average:10.384; most accessible tissue: Callus, score: 46.0	N	N	N	N
vg0720034658	G -> A	LOC_Os07g33520.1	downstream_gene_variant ; 2251.0bp to feature; MODIFIER	silent_mutation	Average:10.384; most accessible tissue: Callus, score: 46.0	N	N	N	N
vg0720034658	G -> A	LOC_Os07g33520-LOC_Os07g33530	intergenic_region ; MODIFIER	silent_mutation	Average:10.384; most accessible tissue: Callus, score: 46.0	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720034658	NA	1.86E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	5.14E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	1.59E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	2.08E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	4.00E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	8.37E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	3.33E-06	4.35E-10	mr1364_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	5.86E-11	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	5.32E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720034658	NA	1.48E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251