Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0720001612:

Variant ID: vg0720001612 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 20001612
Reference Allele: G	Alternative Allele: T,GTT
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGGCTTATGATTAGGGTTTAAAATTTTGGTTCGAAATTTCGGTAATTTTCGCCCCACCCCCCCCACCAGCATGCTCAAATCTCATTCGAAATTTTCGG[G/T,GTT]
TTTTTTTGCATTTTTTGCGAATTTGGTCCAATTGTATTCAAATTCATTCAAAATCAGTCAAAAGTTCAAATAATTTTGGTCAAAAATTTCCGAAATTTCT

Reverse complement sequence

AGAAATTTCGGAAATTTTTGACCAAAATTATTTGAACTTTTGACTGATTTTGAATGAATTTGAATACAATTGGACCAAATTCGCAAAAAATGCAAAAAAA[C/A,AAC]
CCGAAAATTTCGAATGAGATTTGAGCATGCTGGTGGGGGGGGTGGGGCGAAAATTACCGAAATTTCGAACCAAAATTTTAAACCCTAATCATAAGCCCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.10%	20.50%	0.04%	3.47%	GTT: 5.95%
All Indica	2759	79.90%	19.40%	0.00%	0.00%	GTT: 0.69%
All Japonica	1512	63.20%	9.70%	0.00%	10.71%	GTT: 16.34%
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	92.90%	5.60%	0.00%	0.00%	GTT: 1.51%
Indica III	913	59.00%	40.50%	0.00%	0.00%	GTT: 0.44%
Indica Intermediate	786	82.10%	16.90%	0.00%	0.00%	GTT: 1.02%
Temperate Japonica	767	95.30%	2.60%	0.00%	0.13%	GTT: 1.96%
Tropical Japonica	504	12.10%	20.40%	0.00%	31.35%	GTT: 36.11%
Japonica Intermediate	241	68.00%	10.00%	0.00%	1.24%	GTT: 20.75%
VI/Aromatic	96	90.60%	6.20%	1.04%	0.00%	GTT: 2.08%
Intermediate	90	64.40%	17.80%	1.11%	2.22%	GTT: 14.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0720001612	G -> DEL	N	N	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N
vg0720001612	G -> GTT	LOC_Os07g33470.1	upstream_gene_variant ; 1866.0bp to feature; MODIFIER	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N
vg0720001612	G -> GTT	LOC_Os07g33460.1	downstream_gene_variant ; 1300.0bp to feature; MODIFIER	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N
vg0720001612	G -> GTT	LOC_Os07g33460-LOC_Os07g33470	intergenic_region ; MODIFIER	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N
vg0720001612	G -> T	LOC_Os07g33470.1	upstream_gene_variant ; 1867.0bp to feature; MODIFIER	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N
vg0720001612	G -> T	LOC_Os07g33460.1	downstream_gene_variant ; 1299.0bp to feature; MODIFIER	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N
vg0720001612	G -> T	LOC_Os07g33460-LOC_Os07g33470	intergenic_region ; MODIFIER	silent_mutation	Average:33.137; most accessible tissue: Callus, score: 38.515	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0720001612	NA	1.34E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	6.51E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	2.71E-06	NA	mr1438	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	3.56E-06	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	6.90E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	6.56E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	1.45E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	5.57E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	2.83E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	7.72E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	6.43E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	2.91E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	1.33E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0720001612	NA	3.89E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251