Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719933733:

Variant ID: vg0719933733 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19933733
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAGTGTGCAATGTGCAACATATCTAGGGGTGAAAATGGTCATTTCGTAAAAATCCTCTCTCTAGAACAAACAAAAATCATAAAATATTGCATGTGGT[A/G]
TCCTTCAATAAAAAACTAAAATTTTAGGGCGTTCATGGGCAAAGCCACATTCTTGCGATGTCCTCTAGCAAAGATCAAGTTATTTAGTGTCTTGTAGAAA

Reverse complement sequence

TTTCTACAAGACACTAAATAACTTGATCTTTGCTAGAGGACATCGCAAGAATGTGGCTTTGCCCATGAACGCCCTAAAATTTTAGTTTTTTATTGAAGGA[T/C]
ACCACATGCAATATTTTATGATTTTTGTTTGTTCTAGAGAGAGGATTTTTACGAAATGACCATTTTCACCCCTAGATATGTTGCACATTGCACACTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	11.50%	0.53%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	64.00%	34.50%	1.59%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	48.90%	49.00%	2.09%	0.00%	NA
Tropical Japonica	504	91.50%	8.30%	0.20%	0.00%	NA
Japonica Intermediate	241	54.40%	42.70%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719933733	A -> G	LOC_Os07g33340.1	upstream_gene_variant ; 1739.0bp to feature; MODIFIER	silent_mutation	Average:46.074; most accessible tissue: Callus, score: 72.773	N	N	N	N
vg0719933733	A -> G	LOC_Os07g33350.1	upstream_gene_variant ; 1760.0bp to feature; MODIFIER	silent_mutation	Average:46.074; most accessible tissue: Callus, score: 72.773	N	N	N	N
vg0719933733	A -> G	LOC_Os07g33360.1	upstream_gene_variant ; 4710.0bp to feature; MODIFIER	silent_mutation	Average:46.074; most accessible tissue: Callus, score: 72.773	N	N	N	N
vg0719933733	A -> G	LOC_Os07g33350.2	upstream_gene_variant ; 1760.0bp to feature; MODIFIER	silent_mutation	Average:46.074; most accessible tissue: Callus, score: 72.773	N	N	N	N
vg0719933733	A -> G	LOC_Os07g33340-LOC_Os07g33350	intergenic_region ; MODIFIER	silent_mutation	Average:46.074; most accessible tissue: Callus, score: 72.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719933733	3.20E-06	1.26E-13	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733	NA	3.35E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733	NA	1.90E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733	5.22E-11	3.34E-17	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733	1.39E-07	1.18E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719933733	NA	4.69E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	NA	6.86E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	NA	4.26E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	NA	6.02E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	NA	6.29E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	NA	4.82E-10	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	4.23E-06	9.56E-10	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	2.30E-06	NA	mr1807_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719933733	2.34E-07	2.33E-11	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251