Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719741206:

Variant ID: vg0719741206 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 19741206
Reference Allele: T	Alternative Allele: A,TA,TAA,TTAA,TAAA
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, T: 0.19, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCAGAGCCAATCTGCAAATACAGCAACTAGGATTTAAGCATTGATCAACGAGATTAAAATGATGGTATAAAATTAGAGAGCAAACATAATTTTTTTTT[T/A,TA,TAA,TTAA,TAAA]
AAAAAAAGGAAAACATACCCAAGAATCAAAATAAGTCTTGATGTCAATATCTCTCTCAAAAATGGCCTTAGGAAGGAAATAAACACCTCCTTGTATTCCT

Reverse complement sequence

AGGAATACAAGGAGGTGTTTATTTCCTTCCTAAGGCCATTTTTGAGAGAGATATTGACATCAAGACTTATTTTGATTCTTGGGTATGTTTTCCTTTTTTT[A/T,TA,TTA,TTAA,TTTA]
AAAAAAAAATTATGTTTGCTCTCTAATTTTATACCATCATTTTAATCTCGTTGATCAATGCTTAAATCCTAGTTGCTGTATTTGCAGATTGGCTCTGCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	13.40%	0.23%	0.00%	TAA: 3.89%; TTAA: 3.26%; TAAA: 0.47%; TA: 0.38%
All Indica	2759	93.10%	0.70%	0.11%	0.00%	TAA: 5.65%; TA: 0.40%; TAAA: 0.04%
All Japonica	1512	46.50%	39.70%	0.46%	0.00%	TTAA: 9.99%; TAA: 1.52%; TAAA: 1.39%; TA: 0.40%
Aus	269	98.90%	0.00%	0.00%	0.00%	TAA: 0.74%; TA: 0.37%
Indica I	595	99.00%	0.20%	0.00%	0.00%	TA: 0.84%
Indica II	465	98.30%	1.30%	0.00%	0.00%	TA: 0.43%
Indica III	913	86.20%	0.20%	0.11%	0.00%	TAA: 13.36%; TAAA: 0.11%
Indica Intermediate	786	93.80%	1.10%	0.25%	0.00%	TAA: 4.33%; TA: 0.51%
Temperate Japonica	767	43.80%	52.20%	0.52%	0.00%	TAA: 2.61%; TA: 0.78%; TTAA: 0.13%
Tropical Japonica	504	58.10%	11.50%	0.60%	0.00%	TTAA: 29.17%; TAAA: 0.40%; TAA: 0.20%
Japonica Intermediate	241	30.70%	59.30%	0.00%	0.00%	TAAA: 7.88%; TTAA: 1.24%; TAA: 0.83%
VI/Aromatic	96	97.90%	0.00%	0.00%	0.00%	TAA: 2.08%
Intermediate	90	80.00%	14.40%	1.11%	0.00%	TTAA: 3.33%; TAA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719741206	T -> TAA	LOC_Os07g33040.1	downstream_gene_variant ; 4253.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TAA	LOC_Os07g33060.1	downstream_gene_variant ; 2846.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TAA	LOC_Os07g33050.1	intron_variant ; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TA	LOC_Os07g33040.1	downstream_gene_variant ; 4253.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TA	LOC_Os07g33060.1	downstream_gene_variant ; 2846.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TA	LOC_Os07g33050.1	intron_variant ; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TAAA	LOC_Os07g33040.1	downstream_gene_variant ; 4253.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TAAA	LOC_Os07g33060.1	downstream_gene_variant ; 2846.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TAAA	LOC_Os07g33050.1	intron_variant ; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> A	LOC_Os07g33040.1	downstream_gene_variant ; 4252.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> A	LOC_Os07g33060.1	downstream_gene_variant ; 2847.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> A	LOC_Os07g33050.1	intron_variant ; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TTAA	LOC_Os07g33040.1	downstream_gene_variant ; 4253.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TTAA	LOC_Os07g33060.1	downstream_gene_variant ; 2846.0bp to feature; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N
vg0719741206	T -> TTAA	LOC_Os07g33050.1	intron_variant ; MODIFIER	silent_mutation	Average:39.135; most accessible tissue: Callus, score: 72.296	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719741206	2.44E-08	NA	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0719741206	NA	3.76E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719741206	NA	2.66E-09	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719741206	1.50E-06	NA	mr1968_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251