Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719633026:

Variant ID: vg0719633026 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19633026
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCACTGTAGTCAGGTCACACTGTAGCTAACTAGGGGTGGATATATAATAAGCCATCTCGGTTTGACAAGCTTGCTTGCTTAGGCCCTCTTTGTTTAGA[C/T]
TTATAAGCCAACTTATAAGTCAAAAAGTCTAAACCAAAACAAACAAGCAGCTTTTTTATTTGGCTTTTTTAAGCCATAAGCCACTCTAACACTATTAAGG

Reverse complement sequence

CCTTAATAGTGTTAGAGTGGCTTATGGCTTAAAAAAGCCAAATAAAAAAGCTGCTTGTTTGTTTTGGTTTAGACTTTTTGACTTATAAGTTGGCTTATAA[G/A]
TCTAAACAAAGAGGGCCTAAGCAAGCAAGCTTGTCAAACCGAGATGGCTTATTATATATCCACCCCTAGTTAGCTACAGTGTGACCTGACTACAGTGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 42.50% 6.09% 0.13% NA
All Indica  2759 66.50% 23.80% 9.50% 0.22% NA
All Japonica  1512 17.50% 81.70% 0.79% 0.00% NA
Aus  269 82.20% 17.10% 0.74% 0.00% NA
Indica I  595 63.70% 19.30% 16.81% 0.17% NA
Indica II  465 68.00% 22.40% 9.46% 0.22% NA
Indica III  913 70.20% 26.80% 2.96% 0.00% NA
Indica Intermediate  786 63.40% 24.60% 11.58% 0.51% NA
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 39.30% 59.10% 1.59% 0.00% NA
Japonica Intermediate  241 18.30% 80.50% 1.24% 0.00% NA
VI/Aromatic  96 62.50% 35.40% 2.08% 0.00% NA
Intermediate  90 46.70% 42.20% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719633026 C -> DEL N N silent_mutation Average:43.466; most accessible tissue: Callus, score: 84.166 N N N N
vg0719633026 C -> T LOC_Os07g32800.1 upstream_gene_variant ; 4733.0bp to feature; MODIFIER silent_mutation Average:43.466; most accessible tissue: Callus, score: 84.166 N N N N
vg0719633026 C -> T LOC_Os07g32810.1 upstream_gene_variant ; 1344.0bp to feature; MODIFIER silent_mutation Average:43.466; most accessible tissue: Callus, score: 84.166 N N N N
vg0719633026 C -> T LOC_Os07g32820.1 upstream_gene_variant ; 1362.0bp to feature; MODIFIER silent_mutation Average:43.466; most accessible tissue: Callus, score: 84.166 N N N N
vg0719633026 C -> T LOC_Os07g32810-LOC_Os07g32820 intergenic_region ; MODIFIER silent_mutation Average:43.466; most accessible tissue: Callus, score: 84.166 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719633026 NA 4.07E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.29E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.61E-37 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 3.29E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 5.45E-13 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 8.65E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.95E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 8.08E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.31E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.49E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.13E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.52E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.22E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.30E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.76E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 5.21E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.79E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.20E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.81E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.73E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 5.42E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 9.14E-07 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.67E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.23E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 6.98E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.29E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 5.11E-06 4.71E-08 mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.33E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.42E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 9.48E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 6.10E-28 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.44E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.10E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.82E-13 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.58E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.46E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 4.52E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 7.05E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 1.04E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.90E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719633026 NA 2.08E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251