Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719451062:

Variant ID: vg0719451062 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 19451062
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATTGGGTTCTTATATGGACTCTTCTTTCAATATTCTTTATTTTTAATTACGAATTTCAGTTATTTTTAAATTGTATTCCTACTTGGACTCTCATTTT[C/A]
TTTTCTAATTTTATATTTTATTTTATTTTTATTCCGAATTTTGATTAATCTCGTATTGAGTTCTTATATGGACTCTTCTTTCTATATTGCTTATTTTTAA

Reverse complement sequence

TTAAAAATAAGCAATATAGAAAGAAGAGTCCATATAAGAACTCAATACGAGATTAATCAAAATTCGGAATAAAAATAAAATAAAATATAAAATTAGAAAA[G/T]
AAAATGAGAGTCCAAGTAGGAATACAATTTAAAAATAACTGAAATTCGTAATTAAAAATAAAGAATATTGAAAGAAGAGTCCATATAAGAACCCAATATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	4.00%	0.00%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.60%	6.40%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	94.70%	5.30%	0.00%	0.00%	NA
Indica Intermediate	786	90.30%	9.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0719451062	C -> A	LOC_Os07g32620.1	downstream_gene_variant ; 3429.0bp to feature; MODIFIER	silent_mutation	Average:17.1; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0719451062	C -> A	LOC_Os07g32610-LOC_Os07g32620	intergenic_region ; MODIFIER	silent_mutation	Average:17.1; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0719451062	NA	4.67E-07	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	5.74E-07	5.24E-09	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	1.90E-06	4.44E-06	mr1103	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	NA	2.84E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	3.52E-06	3.63E-08	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	1.62E-07	1.60E-09	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	NA	2.46E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	2.77E-07	3.56E-08	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719451062	2.26E-06	8.50E-07	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251