Variant ID: vg0719153643 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 19153643 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATCTTTTGTGGAAAAAAATAGGAAGAAGTAAGTGGGCCCACGTGGAGGGAGGGGCACGCGGGGGGAGAGCCCGATCCGGCTCCCCCCGCGCCGGTCGC[G/A]
CGAAGTGAAGCATTTTCGAAATATTCCACTAATATTTGTAGACCAACTAAACCATGAAAAATGGCCGGACCGTGCCGGGCCAACCCACTTCGCTAGCGCC
GGCGCTAGCGAAGTGGGTTGGCCCGGCACGGTCCGGCCATTTTTCATGGTTTAGTTGGTCTACAAATATTAGTGGAATATTTCGAAAATGCTTCACTTCG[C/T]
GCGACCGGCGCGGGGGGAGCCGGATCGGGCTCTCCCCCCGCGTGCCCCTCCCTCCACGTGGGCCCACTTACTTCTTCCTATTTTTTTCCACAAAAGATGT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.20% | 6.70% | 0.06% | 0.00% | NA |
All Indica | 2759 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 2.50% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0719153643 | G -> A | LOC_Os07g32220-LOC_Os07g32230 | intergenic_region ; MODIFIER | silent_mutation | Average:54.72; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0719153643 | 2.97E-06 | NA | mr1213 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719153643 | NA | 1.45E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719153643 | NA | 3.74E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719153643 | NA | 7.41E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0719153643 | NA | 2.40E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |