Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0719045974:

Variant ID: vg0719045974 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 19045974
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGCGATCCCGACCCTCGTGCTGCTGCCAACCTGGGGCACCGGCCACCTCATGTCCCTGCTCGACGCCGGCAAGCGGCTGCTCGGCTGCCGCGGCGGC[G/A]
GAGGCCTCTCGCTCACGGTGCTCGTCATGCAGCCGCCGAGGAAGGAGTATGCGTCCGCCGTCGCCGCCACCGTGCGCCGGGAGGAGGCATCGGGCCTCGA

Reverse complement sequence

TCGAGGCCCGATGCCTCCTCCCGGCGCACGGTGGCGGCGACGGCGGACGCATACTCCTTCCTCGGCGGCTGCATGACGAGCACCGTGAGCGAGAGGCCTC[C/T]
GCCGCCGCGGCAGCCGAGCAGCCGCTTGCCGGCGTCGAGCAGGGACATGAGGTGGCCGGTGCCCCAGGTTGGCAGCAGCACGAGGGTCGGGATCGCCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 9.00% 1.10% 0.00% NA
All Indica  2759 83.10% 15.10% 1.85% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 0.50% 2.02% 0.00% NA
Indica II  465 47.50% 47.10% 5.38% 0.00% NA
Indica III  913 90.10% 9.40% 0.44% 0.00% NA
Indica Intermediate  786 85.00% 13.70% 1.27% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0719045974 G -> A LOC_Os07g32020.1 missense_variant ; p.Gly34Arg; MODERATE nonsynonymous_codon ; G34R Average:93.4; most accessible tissue: Zhenshan97 flower, score: 99.246 benign 0.396 TOLERATED 0.75

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0719045974 G A 0.01 -0.02 -0.03 -0.01 0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0719045974 4.19E-06 2.60E-07 mr1053 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 3.87E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 4.97E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 4.74E-08 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 1.32E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 8.69E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 4.60E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 2.97E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 7.35E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0719045974 NA 2.75E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251