Search for Variation information by Variation ID:
Detailed information for vg0718817715:
| Variant ID: vg0718817715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18817715 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CTTACTTGGAAGTCCAAGAAACAGGTAGCTGTCTCTCGATCTAGCACCGAGGTAGAACTTCAAGCTCTTGCTACTACCACTTCAGAAATTGTGTGGCTGC[A/G]
TTGGCTACTAGCTGATTTTGGTGTTTCTTGTGATGTCTCCACACCTCTTCTATGTGACAACACTGGAGCAATTCAAATTGCTAATGATCCGGTGAAACAT
Reverse complement sequence
ATGTTTCACCGGATCATTAGCAATTTGAATTGCTCCAGTGTTGTCACATAGAAGAGGTGTGGAGACATCACAAGAAACACCAAAATCAGCTAGTAGCCAA[T/C]
GCAGCCACACAATTTCTGAAGTGGTAGTAGCAAGAGCTTGAAGTTCTACCTCGGTGCTAGATCGAGAGACAGCTACCTGTTTCTTGGACTTCCAAGTAAG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 7.30% | 4.21% | 28.99% | NA |
| All Indica | 2759 | 57.10% | 2.60% | 1.27% | 39.04% | NA |
| All Japonica | 1512 | 71.30% | 17.70% | 10.45% | 0.53% | NA |
| Aus | 269 | 24.20% | 0.00% | 0.37% | 75.46% | NA |
| Indica I | 595 | 80.50% | 3.90% | 0.50% | 15.13% | NA |
| Indica II | 465 | 83.70% | 1.70% | 0.43% | 14.19% | NA |
| Indica III | 913 | 33.60% | 3.20% | 1.53% | 61.66% | NA |
| Indica Intermediate | 786 | 51.00% | 1.40% | 2.04% | 45.55% | NA |
| Temperate Japonica | 767 | 50.10% | 31.60% | 18.12% | 0.26% | NA |
| Tropical Japonica | 504 | 95.80% | 3.20% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 4.10% | 5.81% | 2.49% | NA |
| VI/Aromatic | 96 | 31.20% | 0.00% | 1.04% | 67.71% | NA |
| Intermediate | 90 | 68.90% | 7.80% | 4.44% | 18.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718817715 | A -> DEL | LOC_Os07g31690.1 | N | frameshift_variant | Average:61.528; most accessible tissue: Callus, score: 93.058 | N | N | N | N |
| vg0718817715 | A -> G | LOC_Os07g31690.1 | missense_variant ; p.His689Arg; MODERATE | nonsynonymous_codon ; H689R | Average:61.528; most accessible tissue: Callus, score: 93.058 | probably damaging  |
-2.33 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718817715 | NA | 7.21E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718817715 | NA | 3.64E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718817715 | 3.30E-06 | 3.29E-06 | mr1494 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718817715 | NA | 1.45E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718817715 | NA | 7.65E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718817715 | NA | 4.66E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718817715 | NA | 1.07E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |