Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718661127:

Variant ID: vg0718661127 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18661127
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ACCATAAATCACCTTGTCGCTCACAACGACCACTCATTTAATAAGCGGCATCGAAGTTTTTTCCATACTAATTTATCTTCTGGATACTATAATAGATACT[T/C]
CCTCTATCCTATAATATAAAGCATGGTCAAACTTGACACGGTCTACAAGACTAATCTTTACTACTATCTTATAATTTCTCATATATTATAAGGTTTGTAA

Reverse complement sequence

TTACAAACCTTATAATATATGAGAAATTATAAGATAGTAGTAAAGATTAGTCTTGTAGACCGTGTCAAGTTTGACCATGCTTTATATTATAGGATAGAGG[A/G]
AGTATCTATTATAGTATCCAGAAGATAAATTAGTATGGAAAAAACTTCGATGCCGCTTATTAAATGAGTGGTCGTTGTGAGCGACAAGGTGATTTATGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.70%	21.40%	16.00%	13.90%	NA
All Indica	2759	27.60%	28.10%	23.38%	20.88%	NA
All Japonica	1512	90.70%	0.20%	4.70%	4.43%	NA
Aus	269	11.20%	78.40%	9.67%	0.74%	NA
Indica I	595	22.50%	18.20%	38.66%	20.67%	NA
Indica II	465	30.10%	5.80%	29.25%	34.84%	NA
Indica III	913	31.50%	45.10%	9.86%	13.47%	NA
Indica Intermediate	786	25.40%	29.10%	24.05%	21.37%	NA
Temperate Japonica	767	98.80%	0.10%	0.78%	0.26%	NA
Tropical Japonica	504	83.50%	0.00%	9.13%	7.34%	NA
Japonica Intermediate	241	79.70%	0.80%	7.88%	11.62%	NA
VI/Aromatic	96	92.70%	2.10%	0.00%	5.21%	NA
Intermediate	90	56.70%	20.00%	15.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718661127	T -> DEL	N	N	silent_mutation	Average:33.511; most accessible tissue: Callus, score: 41.63	N	N	N	N
vg0718661127	T -> C	LOC_Os07g31470.1	upstream_gene_variant ; 810.0bp to feature; MODIFIER	silent_mutation	Average:33.511; most accessible tissue: Callus, score: 41.63	N	N	N	N
vg0718661127	T -> C	LOC_Os07g31470-LOC_Os07g31480	intergenic_region ; MODIFIER	silent_mutation	Average:33.511; most accessible tissue: Callus, score: 41.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718661127	NA	1.46E-12	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	NA	1.19E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	NA	2.64E-08	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	NA	4.17E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	NA	7.18E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	1.42E-06	NA	mr1480_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	6.24E-07	2.28E-08	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718661127	NA	6.51E-07	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251