Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0718587094:

Variant ID: vg0718587094 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18587094
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TATCCTCTTACTGACTTTCTCGAATTTAATGTGTGATTCTCTATTCTTCCACATAAGATTGGCTATATGGACATCGAAAAATATAAATATTAATAAATCG[C/T]
TTGTTTACGAGGAATGACTAGTCTCAGACCGTGTCGCATATAATGGCAATGCATCGTACGGTTCGTGTCGCCCTCACGTATGTGCTGCCTCCTCCTCTCC

Reverse complement sequence

GGAGAGGAGGAGGCAGCACATACGTGAGGGCGACACGAACCGTACGATGCATTGCCATTATATGCGACACGGTCTGAGACTAGTCATTCCTCGTAAACAA[G/A]
CGATTTATTAATATTTATATTTTTCGATGTCCATATAGCCAATCTTATGTGGAAGAATAGAGAATCACACATTAAATTCGAGAAAGTCAGTAAGAGGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.00%	31.50%	27.87%	8.55%	NA
All Indica	2759	7.80%	33.90%	44.11%	14.24%	NA
All Japonica	1512	69.10%	28.60%	2.05%	0.26%	NA
Aus	269	48.00%	32.70%	18.22%	1.12%	NA
Indica I	595	2.70%	40.50%	43.03%	13.78%	NA
Indica II	465	3.00%	63.00%	18.92%	15.05%	NA
Indica III	913	12.60%	18.00%	57.83%	11.61%	NA
Indica Intermediate	786	8.90%	30.00%	43.89%	17.18%	NA
Temperate Japonica	767	87.10%	10.70%	1.69%	0.52%	NA
Tropical Japonica	504	46.80%	52.20%	0.99%	0.00%	NA
Japonica Intermediate	241	58.50%	36.10%	5.39%	0.00%	NA
VI/Aromatic	96	92.70%	6.20%	1.04%	0.00%	NA
Intermediate	90	40.00%	34.40%	21.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718587094	C -> DEL	N	N	silent_mutation	Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953	N	N	N	N
vg0718587094	C -> T	LOC_Os07g31370.1	upstream_gene_variant ; 4230.0bp to feature; MODIFIER	silent_mutation	Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953	N	N	N	N
vg0718587094	C -> T	LOC_Os07g31380.1	upstream_gene_variant ; 220.0bp to feature; MODIFIER	silent_mutation	Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953	N	N	N	N
vg0718587094	C -> T	LOC_Os07g31370-LOC_Os07g31380	intergenic_region ; MODIFIER	silent_mutation	Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0718587094	C	T	0.0	-0.03	-0.03	-0.01	-0.02	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718587094	NA	7.23E-08	Grain_weight	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718587094	NA	2.77E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	7.49E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	2.25E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	1.17E-06	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	2.21E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	2.75E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	3.38E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	1.21E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	4.22E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	9.01E-06	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	9.17E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094	NA	3.29E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251