Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718516017:

Variant ID: vg0718516017 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18516017
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATCGAGATCTCTAAACTTGGTTTAATGTATCATCCCGGTCTAAAGCTGCGTTTGACCATAGTCTTGCCTATGTGGCATGCTACGTGGACGATGATAT[G/A]
GAATTTTTTTCTCCCTTCTTCCTTCTTTTTTTCTCTCTTCTTCTCCCTTTTTTTCTCCACTTTGCCTCCTTCCTCTCCCTTCTGCCGCTGACAGGTGAGA

Reverse complement sequence

TCTCACCTGTCAGCGGCAGAAGGGAGAGGAAGGAGGCAAAGTGGAGAAAAAAAGGGAGAAGAAGAGAGAAAAAAAGAAGGAAGAAGGGAGAAAAAAATTC[C/T]
ATATCATCGTCCACGTAGCATGCCACATAGGCAAGACTATGGTCAAACGCAGCTTTAGACCGGGATGATACATTAAACCAAGTTTAGAGATCTCGATGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 8.20% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 76.20% 23.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 69.30% 30.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718516017 G -> A LOC_Os07g31280.1 upstream_gene_variant ; 3341.0bp to feature; MODIFIER silent_mutation Average:73.67; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0718516017 G -> A LOC_Os07g31280.2 upstream_gene_variant ; 3374.0bp to feature; MODIFIER silent_mutation Average:73.67; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0718516017 G -> A LOC_Os07g31280.3 upstream_gene_variant ; 3374.0bp to feature; MODIFIER silent_mutation Average:73.67; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0718516017 G -> A LOC_Os07g31270.1 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:73.67; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0718516017 G -> A LOC_Os07g31270-LOC_Os07g31280 intergenic_region ; MODIFIER silent_mutation Average:73.67; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718516017 G A -0.09 -0.06 -0.05 -0.06 -0.09 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718516017 NA 9.91E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718516017 NA 1.83E-12 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718516017 NA 1.43E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 3.61E-06 1.17E-28 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 1.63E-06 7.53E-23 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 NA 3.84E-09 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 NA 6.56E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 2.55E-09 7.45E-34 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 NA 4.21E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 6.11E-06 1.90E-23 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 NA 5.63E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 NA 3.04E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 2.24E-08 2.01E-18 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718516017 NA 1.64E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251