Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718107300:

Variant ID: vg0718107300 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18107300
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTTTTAAATAAAGTTTGTGAATAGAGATACATACGTCTAAAAGTCTAGCGCATATGGGATCTATGTGAGGTCCAACCGTTTGCATGACGCGTACAA[C/T]
GCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTTTTGACTTGGGATTTAGCCTCTCAAAAAA

Reverse complement sequence

TTTTTTGAGAGGCTAAATCCCAAGTCAAAAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGC[G/A]
TTGTACGCGTCATGCAAACGGTTGGACCTCACATAGATCCCATATGCGCTAGACTTTTAGACGTATGTATCTCTATTCACAAACTTTATTTAAAAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.20%	0.13%	0.36%	NA
All Indica	2759	46.50%	52.80%	0.18%	0.54%	NA
All Japonica	1512	87.20%	12.70%	0.07%	0.00%	NA
Aus	269	68.80%	30.90%	0.00%	0.37%	NA
Indica I	595	24.00%	75.10%	0.17%	0.67%	NA
Indica II	465	76.30%	22.60%	0.43%	0.65%	NA
Indica III	913	40.10%	59.60%	0.11%	0.22%	NA
Indica Intermediate	786	53.30%	45.80%	0.13%	0.76%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	68.50%	31.30%	0.20%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	6.20%	0.00%	1.04%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718107300	C -> DEL	N	N	silent_mutation	Average:44.721; most accessible tissue: Callus, score: 79.831	N	N	N	N
vg0718107300	C -> T	LOC_Os07g30590.1	upstream_gene_variant ; 3585.0bp to feature; MODIFIER	silent_mutation	Average:44.721; most accessible tissue: Callus, score: 79.831	N	N	N	N
vg0718107300	C -> T	LOC_Os07g30600.1	intron_variant ; MODIFIER	silent_mutation	Average:44.721; most accessible tissue: Callus, score: 79.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718107300	NA	2.55E-06	mr1480	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	5.72E-07	NA	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	1.55E-06	1.83E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	NA	6.47E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	1.13E-06	NA	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	6.90E-09	1.87E-09	mr1480_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	NA	2.99E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	NA	2.23E-06	mr1711_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	5.52E-06	NA	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300	1.76E-06	3.76E-10	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251