Variant ID: vg0718107292 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 18107292 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )
ATTAGAGAATTTTTTTTAAATAAAGTTTGTGAATAGAGATACATACGTCTAAAAGTCTAGCGCATATGGGATCTATGTGAGGTCCAACCGTTTGCATGAC[G/A]
CGTACAACGCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTTTTGACTTGGGATTTAGCCTC
GAGGCTAAATCCCAAGTCAAAAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGCGTTGTACG[C/T]
GTCATGCAAACGGTTGGACCTCACATAGATCCCATATGCGCTAGACTTTTAGACGTATGTATCTCTATTCACAAACTTTATTTAAAAAAAATTCTCTAAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 65.40% | 34.10% | 0.13% | 0.36% | NA |
All Indica | 2759 | 51.60% | 47.60% | 0.18% | 0.54% | NA |
All Japonica | 1512 | 87.20% | 12.70% | 0.07% | 0.00% | NA |
Aus | 269 | 70.60% | 29.00% | 0.00% | 0.37% | NA |
Indica I | 595 | 25.00% | 74.10% | 0.17% | 0.67% | NA |
Indica II | 465 | 76.60% | 22.40% | 0.43% | 0.65% | NA |
Indica III | 913 | 47.40% | 52.20% | 0.11% | 0.22% | NA |
Indica Intermediate | 786 | 62.00% | 37.20% | 0.13% | 0.76% | NA |
Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 68.50% | 31.30% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0718107292 | G -> DEL | N | N | silent_mutation | Average:44.405; most accessible tissue: Callus, score: 79.831 | N | N | N | N |
vg0718107292 | G -> A | LOC_Os07g30590.1 | upstream_gene_variant ; 3577.0bp to feature; MODIFIER | silent_mutation | Average:44.405; most accessible tissue: Callus, score: 79.831 | N | N | N | N |
vg0718107292 | G -> A | LOC_Os07g30600.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.405; most accessible tissue: Callus, score: 79.831 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0718107292 | 2.97E-07 | NA | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | 5.41E-07 | 1.20E-07 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | NA | 8.53E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | NA | 9.24E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | 5.46E-06 | NA | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | 8.08E-09 | 5.92E-09 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | NA | 5.33E-06 | mr1679_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0718107292 | 1.99E-07 | 5.77E-11 | mr1968_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |