Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718107292:

Variant ID: vg0718107292 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18107292
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGAGAATTTTTTTTAAATAAAGTTTGTGAATAGAGATACATACGTCTAAAAGTCTAGCGCATATGGGATCTATGTGAGGTCCAACCGTTTGCATGAC[G/A]
CGTACAACGCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTTTTGACTTGGGATTTAGCCTC

Reverse complement sequence

GAGGCTAAATCCCAAGTCAAAAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGCGTTGTACG[C/T]
GTCATGCAAACGGTTGGACCTCACATAGATCCCATATGCGCTAGACTTTTAGACGTATGTATCTCTATTCACAAACTTTATTTAAAAAAAATTCTCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	34.10%	0.13%	0.36%	NA
All Indica	2759	51.60%	47.60%	0.18%	0.54%	NA
All Japonica	1512	87.20%	12.70%	0.07%	0.00%	NA
Aus	269	70.60%	29.00%	0.00%	0.37%	NA
Indica I	595	25.00%	74.10%	0.17%	0.67%	NA
Indica II	465	76.60%	22.40%	0.43%	0.65%	NA
Indica III	913	47.40%	52.20%	0.11%	0.22%	NA
Indica Intermediate	786	62.00%	37.20%	0.13%	0.76%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	68.50%	31.30%	0.20%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	6.20%	0.00%	1.04%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718107292	G -> DEL	N	N	silent_mutation	Average:44.405; most accessible tissue: Callus, score: 79.831	N	N	N	N
vg0718107292	G -> A	LOC_Os07g30590.1	upstream_gene_variant ; 3577.0bp to feature; MODIFIER	silent_mutation	Average:44.405; most accessible tissue: Callus, score: 79.831	N	N	N	N
vg0718107292	G -> A	LOC_Os07g30600.1	intron_variant ; MODIFIER	silent_mutation	Average:44.405; most accessible tissue: Callus, score: 79.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718107292	2.97E-07	NA	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	5.41E-07	1.20E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	NA	8.53E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	NA	9.24E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	5.46E-06	NA	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	8.08E-09	5.92E-09	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	NA	5.33E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107292	1.99E-07	5.77E-11	mr1968_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251