Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718105499:

Variant ID: vg0718105499 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18105499
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.47, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGTCTCGGATATGTCTAATGGTTGCTATAATTCCACCCGTCACAGGTAGGTGGCCACCTATATATGACGGGCCGCCATTTGCACCCCGACAGAGGTCG[A/G]
GTCTCGGACGATGACCTCACCTGTTATTACGACATTCTGTTGGACCTGCCACTGGTGAAGTCATCCATAACAAGCACTTTGGGCTATCACAGGTGGGCCG

Reverse complement sequence

CGGCCCACCTGTGATAGCCCAAAGTGCTTGTTATGGATGACTTCACCAGTGGCAGGTCCAACAGAATGTCGTAATAACAGGTGAGGTCATCGTCCGAGAC[T/C]
CGACCTCTGTCGGGGTGCAAATGGCGGCCCGTCATATATAGGTGGCCACCTACCTGTGACGGGTGGAATTATAGCAACCATTAGACATATCCGAGACCCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	46.20%	0.32%	3.20%	NA
All Indica	2759	26.40%	67.90%	0.47%	5.33%	NA
All Japonica	1512	86.90%	12.90%	0.07%	0.13%	NA
Aus	269	69.90%	29.70%	0.00%	0.37%	NA
Indica I	595	14.50%	83.70%	0.34%	1.51%	NA
Indica II	465	12.70%	85.20%	1.08%	1.08%	NA
Indica III	913	33.60%	59.10%	0.22%	7.01%	NA
Indica Intermediate	786	35.00%	55.70%	0.51%	8.78%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	69.00%	30.80%	0.00%	0.20%	NA
Japonica Intermediate	241	85.90%	13.30%	0.41%	0.41%	NA
VI/Aromatic	96	92.70%	6.20%	0.00%	1.04%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718105499	A -> DEL	N	N	silent_mutation	Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N
vg0718105499	A -> G	LOC_Os07g30590.1	upstream_gene_variant ; 1784.0bp to feature; MODIFIER	silent_mutation	Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N
vg0718105499	A -> G	LOC_Os07g30600.1	upstream_gene_variant ; 726.0bp to feature; MODIFIER	silent_mutation	Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N
vg0718105499	A -> G	LOC_Os07g30590-LOC_Os07g30600	intergenic_region ; MODIFIER	silent_mutation	Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718105499	NA	3.06E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	3.35E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	9.63E-07	mr1480	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	3.04E-06	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	1.91E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	3.06E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	7.64E-06	NA	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	1.09E-08	9.81E-12	mr1480_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	3.92E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	8.29E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499	NA	1.46E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251