Search for Variation information by Variation ID:
Detailed information for vg0718025848:
| Variant ID: vg0718025848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18025848 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ACTTGGCGCACGTAGGCGTCCATCTGTGGGTCAGAGCACCGGTACTCCTTACAGACTTGGTTAACGACCAGCTGGGAGTCGCCTAACACCAGGAGGCGGC[T/G]
GATCCCCAGTCCAGCTGCCACTCTGAGTCCGGCAAGGAGTCCCTCATACTCTGCCATATTATTGGTCGCTCGAAAGTCGAGGCGGACCAAATATCTGAGG
Reverse complement sequence
CCTCAGATATTTGGTCCGCCTCGACTTTCGAGCGACCAATAATATGGCAGAGTATGAGGGACTCCTTGCCGGACTCAGAGTGGCAGCTGGACTGGGGATC[A/C]
GCCGCCTCCTGGTGTTAGGCGACTCCCAGCTGGTCGTTAACCAAGTCTGTAAGGAGTACCGGTGCTCTGACCCACAGATGGACGCCTACGTGCGCCAAGT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.40% | 4.40% | 26.96% | 21.18% | NA |
| All Indica | 2759 | 45.90% | 1.10% | 35.45% | 17.62% | NA |
| All Japonica | 1512 | 56.00% | 0.20% | 14.15% | 29.70% | NA |
| Aus | 269 | 7.80% | 64.30% | 20.45% | 7.43% | NA |
| Indica I | 595 | 84.90% | 0.20% | 7.73% | 7.23% | NA |
| Indica II | 465 | 21.10% | 0.00% | 55.05% | 23.87% | NA |
| Indica III | 913 | 31.70% | 0.70% | 49.62% | 18.07% | NA |
| Indica Intermediate | 786 | 47.60% | 2.80% | 28.37% | 21.25% | NA |
| Temperate Japonica | 767 | 59.70% | 0.00% | 8.08% | 32.20% | NA |
| Tropical Japonica | 504 | 51.20% | 0.20% | 23.41% | 25.20% | NA |
| Japonica Intermediate | 241 | 53.90% | 0.80% | 14.11% | 31.12% | NA |
| VI/Aromatic | 96 | 54.20% | 2.10% | 9.38% | 34.38% | NA |
| Intermediate | 90 | 63.30% | 2.20% | 20.00% | 14.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718025848 | T -> DEL | LOC_Os07g30460.1 | N | frameshift_variant | Average:26.409; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0718025848 | T -> G | LOC_Os07g30460.1 | missense_variant ; p.Ser1383Arg; MODERATE | nonsynonymous_codon ; S1383R | Average:26.409; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | possibly damaging  |
-1.664 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718025848 | NA | 4.75E-15 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 1.00E-40 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 8.61E-48 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 2.89E-44 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | 7.83E-07 | NA | mr1134_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 4.56E-09 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 3.49E-36 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 9.84E-55 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718025848 | NA | 1.37E-30 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |