Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718004907:

Variant ID: vg0718004907 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18004907
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, C: 0.07, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:

CACGGCCCATCAAGAGTTCACGGACTATATTTTCAGTTGTGTTCTGTCATGTACCTTTAGGGATTAAGCATTTTTGCTCTTGGCAATACATGCGTGCTCA[A/C]
GTGTCTAATATATACCTTAAATCTTTTTATATATCTGATACACAACTTTTCAGTAGTTGGCACAATACAATTTAAAAGGTGGCAAAAGTAAAGCTTTACG

Reverse complement sequence

CGTAAAGCTTTACTTTTGCCACCTTTTAAATTGTATTGTGCCAACTACTGAAAAGTTGTGTATCAGATATATAAAAAGATTTAAGGTATATATTAGACAC[T/G]
TGAGCACGCATGTATTGCCAAGAGCAAAAATGCTTAATCCCTAAAGGTACATGACAGAACACAACTGAAAATATAGTCCGTGAACTCTTGATGGGCCGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.90%	37.80%	1.14%	19.15%	NA
All Indica	2759	15.10%	60.70%	1.67%	22.54%	NA
All Japonica	1512	82.90%	0.90%	0.40%	15.81%	NA
Aus	269	72.50%	27.10%	0.00%	0.37%	NA
Indica I	595	31.30%	56.00%	1.85%	10.92%	NA
Indica II	465	8.00%	80.20%	1.29%	10.54%	NA
Indica III	913	3.10%	61.10%	1.53%	34.28%	NA
Indica Intermediate	786	21.10%	52.20%	1.91%	24.81%	NA
Temperate Japonica	767	89.70%	0.80%	0.39%	9.13%	NA
Tropical Japonica	504	77.60%	0.40%	0.60%	21.43%	NA
Japonica Intermediate	241	72.60%	2.10%	0.00%	25.31%	NA
VI/Aromatic	96	65.60%	3.10%	1.04%	30.21%	NA
Intermediate	90	57.80%	25.60%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718004907	A -> DEL	N	N	silent_mutation	Average:29.423; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0718004907	A -> C	LOC_Os07g30420.1	downstream_gene_variant ; 999.0bp to feature; MODIFIER	silent_mutation	Average:29.423; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0718004907	A -> C	LOC_Os07g30410-LOC_Os07g30420	intergenic_region ; MODIFIER	silent_mutation	Average:29.423; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718004907	NA	2.79E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	NA	1.37E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	4.01E-06	NA	mr1015_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	5.42E-06	1.80E-10	mr1047_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	NA	4.31E-09	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	NA	5.19E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	NA	6.98E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	NA	3.36E-11	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718004907	2.18E-06	5.80E-09	mr1834_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251