Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717727677:

Variant ID: vg0717727677 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17727677
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTCCGGAAAGTTGTTGCAGGATCTATAGTCCGTCAACCCAGGAAGAGTCAGCAAAGGATGGTCGAAGAAGTGAAATGTCATGCCATGGAAAGGACCT[C/T]
TTGAGTTGGATCTGTTAAGTGATCAGTGCTTGTTTCAAGGAATGTTAACTATGCAATCTGTTTAGGCATATGACACCAAAAATCAAGTCAGAAGCAAGAT

Reverse complement sequence

ATCTTGCTTCTGACTTGATTTTTGGTGTCATATGCCTAAACAGATTGCATAGTTAACATTCCTTGAAACAAGCACTGATCACTTAACAGATCCAACTCAA[G/A]
AGGTCCTTTCCATGGCATGACATTTCACTTCTTCGACCATCCTTTGCTGACTCTTCCTGGGTTGACGGACTATAGATCCTGCAACAACTTTCCGGAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	5.70%	4.74%	2.60%	NA
All Indica	2759	83.20%	9.40%	7.07%	0.33%	NA
All Japonica	1512	92.40%	0.30%	1.59%	5.69%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	86.20%	8.90%	4.87%	0.00%	NA
Indica II	465	84.50%	8.20%	7.31%	0.00%	NA
Indica III	913	76.90%	12.70%	9.42%	0.99%	NA
Indica Intermediate	786	87.50%	6.60%	5.85%	0.00%	NA
Temperate Japonica	767	93.70%	0.00%	1.30%	4.95%	NA
Tropical Japonica	504	94.00%	1.00%	2.38%	2.58%	NA
Japonica Intermediate	241	84.60%	0.00%	0.83%	14.52%	NA
VI/Aromatic	96	66.70%	3.10%	4.17%	26.04%	NA
Intermediate	90	94.40%	3.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717727677	C -> DEL	N	N	silent_mutation	Average:11.55; most accessible tissue: Callus, score: 34.647	N	N	N	N
vg0717727677	C -> T	LOC_Os07g30060.1	upstream_gene_variant ; 3663.0bp to feature; MODIFIER	silent_mutation	Average:11.55; most accessible tissue: Callus, score: 34.647	N	N	N	N
vg0717727677	C -> T	LOC_Os07g30050.1	downstream_gene_variant ; 1011.0bp to feature; MODIFIER	silent_mutation	Average:11.55; most accessible tissue: Callus, score: 34.647	N	N	N	N
vg0717727677	C -> T	LOC_Os07g30050-LOC_Os07g30060	intergenic_region ; MODIFIER	silent_mutation	Average:11.55; most accessible tissue: Callus, score: 34.647	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717727677	7.40E-06	1.24E-09	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	NA	5.09E-08	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	8.60E-11	4.62E-17	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	3.26E-09	1.62E-16	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	4.39E-06	NA	mr1538_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	1.12E-06	1.81E-09	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	2.76E-07	2.96E-11	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	1.28E-06	1.33E-10	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	NA	9.48E-20	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727677	NA	7.73E-16	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251