Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717601450:

Variant ID: vg0717601450 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17601450
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTACATACTCCATAGATTATATTTTCGCAATCGGTTAGCACTACCATGCCACCCTCTGGGCTGCCGACGTGAGCTCGACCGCCGCCAATGGAGGCGCT[T/C]
GTCGGCAAGTACCTTCCACACCTTGCCGAAGGTTGGCAAACTACCTAAACCCTTCTAAGTACATCGTAGATGCTCTAGGAACCCTCCCCGAGCTATGTCA

Reverse complement sequence

TGACATAGCTCGGGGAGGGTTCCTAGAGCATCTACGATGTACTTAGAAGGGTTTAGGTAGTTTGCCAACCTTCGGCAAGGTGTGGAAGGTACTTGCCGAC[A/G]
AGCGCCTCCATTGGCGGCGGTCGAGCTCACGTCGGCAGCCCAGAGGGTGGCATGGTAGTGCTAACCGATTGCGAAAATATAATCTATGGAGTATGTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	6.40%	4.02%	29.96%	NA
All Indica	2759	40.30%	10.50%	6.27%	42.91%	NA
All Japonica	1512	89.60%	0.10%	0.40%	9.99%	NA
Aus	269	73.60%	4.10%	2.23%	20.07%	NA
Indica I	595	49.90%	7.20%	2.52%	40.34%	NA
Indica II	465	18.90%	13.80%	13.12%	54.19%	NA
Indica III	913	39.20%	12.40%	7.01%	41.40%	NA
Indica Intermediate	786	47.10%	8.80%	4.20%	39.95%	NA
Temperate Japonica	767	99.20%	0.00%	0.13%	0.65%	NA
Tropical Japonica	504	77.00%	0.20%	0.79%	22.02%	NA
Japonica Intermediate	241	85.10%	0.00%	0.41%	14.52%	NA
VI/Aromatic	96	90.60%	0.00%	3.12%	6.25%	NA
Intermediate	90	71.10%	3.30%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717601450	T -> DEL	N	N	silent_mutation	Average:25.037; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0717601450	T -> C	LOC_Os07g29910.1	upstream_gene_variant ; 2163.0bp to feature; MODIFIER	silent_mutation	Average:25.037; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0717601450	T -> C	LOC_Os07g29900-LOC_Os07g29910	intergenic_region ; MODIFIER	silent_mutation	Average:25.037; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717601450	2.45E-11	2.81E-10	mr1547	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601450	1.45E-09	3.43E-10	mr1547	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601450	NA	8.34E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601450	NA	3.66E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601450	NA	3.06E-07	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601450	NA	3.91E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601450	2.66E-06	2.34E-08	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251