Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717601057:

Variant ID: vg0717601057 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17601057
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCCGAGCTCATCCACTTCTTCTTGCCCTATAAATAGGACCCCAAGCCCTTCCTTGTCCATCATCGATCATCACCAACCATAACCCCACAACCCCGAAGC[T/C]
CTGCTTTGCCAATCCATCTCATCAACCATCCTCGCCCGTCAATCGAACACCTTGTGCATGATCGACTATACACCTCTCCATCCACTCTCCACCCTAACCA

Reverse complement sequence

TGGTTAGGGTGGAGAGTGGATGGAGAGGTGTATAGTCGATCATGCACAAGGTGTTCGATTGACGGGCGAGGATGGTTGATGAGATGGATTGGCAAAGCAG[A/G]
GCTTCGGGGTTGTGGGGTTATGGTTGGTGATGATCGATGATGGACAAGGAAGGGCTTGGGGTCCTATTTATAGGGCAAGAAGAAGTGGATGAGCTCGGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	4.80%	3.22%	22.62%	NA
All Indica	2759	56.30%	7.60%	4.82%	31.24%	NA
All Japonica	1512	89.90%	0.10%	0.13%	9.85%	NA
Aus	269	77.30%	5.60%	4.83%	12.27%	NA
Indica I	595	62.20%	0.50%	2.52%	34.79%	NA
Indica II	465	42.80%	15.50%	5.81%	35.91%	NA
Indica III	913	55.80%	10.50%	5.91%	27.82%	NA
Indica Intermediate	786	60.40%	5.10%	4.71%	29.77%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	77.60%	0.40%	0.40%	21.63%	NA
Japonica Intermediate	241	85.50%	0.00%	0.00%	14.52%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	73.30%	1.10%	4.44%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717601057	T -> DEL	N	N	silent_mutation	Average:15.302; most accessible tissue: Callus, score: 44.213	N	N	N	N
vg0717601057	T -> C	LOC_Os07g29910.1	upstream_gene_variant ; 2556.0bp to feature; MODIFIER	silent_mutation	Average:15.302; most accessible tissue: Callus, score: 44.213	N	N	N	N
vg0717601057	T -> C	LOC_Os07g29900-LOC_Os07g29910	intergenic_region ; MODIFIER	silent_mutation	Average:15.302; most accessible tissue: Callus, score: 44.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717601057	1.53E-06	8.33E-08	mr1121	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057	NA	1.87E-08	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057	NA	3.97E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057	NA	1.04E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057	NA	9.06E-08	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057	NA	1.13E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057	NA	9.22E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251