Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717315974:

Variant ID: vg0717315974 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17315974
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

GTGAAGCTGTTGATCAAAAGGAGTATAGAAGTATGATTGGATCTTTGTTGTATCTAACTTCTTCTAGGCCAAACATACAATTTGTTGTGTGTTTGTGTGC[G/A]
CGCTTTCAAGCTTCTCCTCGTGCTTCACATCGTCAAGCGGTCAAGCGAATAATGAGGTATTTAAATCATACCCTTGAGTTTGGAATTTGGTATTCTACTT

Reverse complement sequence

AAGTAGAATACCAAATTCCAAACTCAAGGGTATGATTTAAATACCTCATTATTCGCTTGACCGCTTGACGATGTGAAGCACGAGGAGAAGCTTGAAAGCG[C/T]
GCACACAAACACACAACAAATTGTATGTTTGGCCTAGAAGAAGTTAGATACAACAAAGATCCAATCATACTTCTATACTCCTTTTGATCAACAGCTTCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	37.80%	0.78%	0.02%	NA
All Indica	2759	37.00%	62.70%	0.29%	0.00%	NA
All Japonica	1512	97.40%	0.70%	1.85%	0.07%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	45.00%	54.80%	0.17%	0.00%	NA
Indica II	465	16.30%	83.40%	0.22%	0.00%	NA
Indica III	913	39.60%	60.00%	0.33%	0.00%	NA
Indica Intermediate	786	39.90%	59.70%	0.38%	0.00%	NA
Temperate Japonica	767	99.00%	0.90%	0.13%	0.00%	NA
Tropical Japonica	504	96.40%	0.20%	3.17%	0.20%	NA
Japonica Intermediate	241	94.60%	0.80%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717315974	G -> DEL	LOC_Os07g29490.1	N	frameshift_variant	Average:16.369; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg0717315974	G -> A	LOC_Os07g29490.1	synonymous_variant ; p.Ala143Ala; LOW	synonymous_codon	Average:16.369; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717315974	NA	5.20E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974	1.34E-06	2.15E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974	NA	5.20E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974	NA	2.42E-07	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974	1.58E-06	2.92E-06	mr1878	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974	NA	1.01E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974	NA	8.03E-07	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251