Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716828450:

Variant ID: vg0716828450 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16828450
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CACATGCAAGACCCACACACACAACCAAACTTAAGCAAGCAAACTAACATAACGATCTAAGACAACGACTTAGCAAAACGGTCTAGGTCTTCCGGGCATC[G/A]
GAGTTGATTGAAGGCTCATTCGGCACGTCCCCATCATCTTGAGTTGGTCCCCACTCGATCTTGGAATGGGTACGCTTGGATTCTTCTTCATCATCATCAC

Reverse complement sequence

GTGATGATGATGAAGAAGAATCCAAGCGTACCCATTCCAAGATCGAGTGGGGACCAACTCAAGATGATGGGGACGTGCCGAATGAGCCTTCAATCAACTC[C/T]
GATGCCCGGAAGACCTAGACCGTTTTGCTAAGTCGTTGTCTTAGATCGTTATGTTAGTTTGCTTGCTTAAGTTTGGTTGTGTGTGTGGGTCTTGCATGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 4.30% 2.07% 0.00% NA
All Indica  2759 89.30% 7.20% 3.44% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 88.40% 7.50% 4.09% 0.00% NA
Indica III  913 79.40% 15.60% 5.04% 0.00% NA
Indica Intermediate  786 93.50% 2.90% 3.56% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716828450 G -> A LOC_Os07g28760.1 upstream_gene_variant ; 4828.0bp to feature; MODIFIER silent_mutation Average:64.07; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N
vg0716828450 G -> A LOC_Os07g28750.1 intron_variant ; MODIFIER silent_mutation Average:64.07; most accessible tissue: Zhenshan97 flag leaf, score: 91.601 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0716828450 G A 0.0 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716828450 NA 2.10E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 1.49E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 2.82E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 1.96E-10 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 1.70E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 8.62E-06 8.61E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 3.21E-07 5.08E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 7.79E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 6.83E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 1.49E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 1.69E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 2.40E-07 2.04E-08 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716828450 NA 9.62E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251