Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716507613:

Variant ID: vg0716507613 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16507613
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTATTAGATAAGTTACAATATAAACATTAAAACTTGCAATTAAAACTTGCAATGTAATTACAGTATATTAAATTTTTTTGTGTAATTATAATATAAGT[T/G]
TAGGCTAGTGTAAAAATGATCTGATTATTTTTTTAGTAAAAAATATGAAGCTATGGTAAAAACTACTCCTATGAAGCTAGTCTCTAAGGCCATATGTGTA

Reverse complement sequence

TACACATATGGCCTTAGAGACTAGCTTCATAGGAGTAGTTTTTACCATAGCTTCATATTTTTTACTAAAAAAATAATCAGATCATTTTTACACTAGCCTA[A/C]
ACTTATATTATAATTACACAAAAAAATTTAATATACTGTAATTACATTGCAAGTTTTAATTGCAAGTTTTAATGTTTATATTGTAACTTATCTAATACAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	35.80%	1.57%	0.00%	NA
All Indica	2759	77.60%	22.10%	0.36%	0.00%	NA
All Japonica	1512	32.00%	63.90%	4.10%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	58.50%	41.20%	0.34%	0.00%	NA
Indica II	465	96.10%	3.70%	0.22%	0.00%	NA
Indica III	913	81.80%	17.90%	0.33%	0.00%	NA
Indica Intermediate	786	76.10%	23.40%	0.51%	0.00%	NA
Temperate Japonica	767	23.70%	69.90%	6.39%	0.00%	NA
Tropical Japonica	504	50.20%	48.40%	1.39%	0.00%	NA
Japonica Intermediate	241	20.30%	77.20%	2.49%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	56.70%	41.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716507613	T -> G	LOC_Os07g28260.1	upstream_gene_variant ; 4804.0bp to feature; MODIFIER	silent_mutation	Average:29.487; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0716507613	T -> G	LOC_Os07g28260.6	upstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:29.487; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0716507613	T -> G	LOC_Os07g28260.4	upstream_gene_variant ; 4896.0bp to feature; MODIFIER	silent_mutation	Average:29.487; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0716507613	T -> G	LOC_Os07g28260.5	upstream_gene_variant ; 4990.0bp to feature; MODIFIER	silent_mutation	Average:29.487; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0716507613	T -> G	LOC_Os07g28250.1	downstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:29.487; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0716507613	T -> G	LOC_Os07g28250-LOC_Os07g28260	intergenic_region ; MODIFIER	silent_mutation	Average:29.487; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716507613	NA	5.76E-08	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716507613	NA	1.42E-08	mr1702_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716507613	NA	6.48E-07	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251