Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716330932:

Variant ID: vg0716330932 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16330932
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAAGTATTTCTGCGCCATTGCTGGGAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACAATTATGAACTCCTCCCTAGCTTTATAGCCATGGTT[T/C]
GGGACCAATCCTTCTCCAGACTTGACCATGAAAAATCTATACCACCATCTGCGAGAGTTTGAGCAACCGTGCTCGTGCATGATGATTTCAGGCATGACAC

Reverse complement sequence

GTGTCATGCCTGAAATCATCATGCACGAGCACGGTTGCTCAAACTCTCGCAGATGGTGGTATAGATTTTTCATGGTCAAGTCTGGAGAAGGATTGGTCCC[A/G]
AACCATGGCTATAAAGCTAGGGAGGAGTTCATAATTGTTGGTATTTCTTAACGACATTACTAGAAATATAATTCCCAGCAATGGCGCAGAAATACTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	32.00%	0.11%	2.07%	NA
All Indica	2759	53.40%	42.90%	0.14%	3.52%	NA
All Japonica	1512	97.40%	2.60%	0.07%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	60.80%	39.00%	0.17%	0.00%	NA
Indica II	465	18.10%	78.90%	0.43%	2.58%	NA
Indica III	913	71.90%	21.70%	0.00%	6.46%	NA
Indica Intermediate	786	47.30%	49.20%	0.13%	3.31%	NA
Temperate Japonica	767	95.40%	4.40%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716330932	T -> DEL	N	N	silent_mutation	Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826	N	N	N	N
vg0716330932	T -> C	LOC_Os07g27980.1	upstream_gene_variant ; 3376.0bp to feature; MODIFIER	silent_mutation	Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826	N	N	N	N
vg0716330932	T -> C	LOC_Os07g28000.1	upstream_gene_variant ; 2043.0bp to feature; MODIFIER	silent_mutation	Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826	N	N	N	N
vg0716330932	T -> C	LOC_Os07g27980-LOC_Os07g28000	intergenic_region ; MODIFIER	silent_mutation	Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716330932	NA	4.96E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932	NA	4.81E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932	2.70E-07	7.83E-08	mr1705	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932	NA	3.10E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932	4.50E-08	9.92E-13	mr1705_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251