| Variant ID: vg0716123713 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16123713 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 120. )
GATATTTTTCTTTTCCTCTAACTCACTACATCAATTGGTTCGCCATTGACTAGTGAGTCGGGGGCTAGAGATGCTATGTCATATTTTTTCAACAATTTTC[A/G]
TAATATTTATCTTGATTGCTTGCGACATAATCTGAGTACAAAAGTGACTATCGAGTTATGGAGTTCTATCTTCCTATGCTTTCCGTTTGGTTTGTCGATG
CATCGACAAACCAAACGGAAAGCATAGGAAGATAGAACTCCATAACTCGATAGTCACTTTTGTACTCAGATTATGTCGCAAGCAATCAAGATAAATATTA[T/C]
GAAAATTGTTGAAAAAATATGACATAGCATCTCTAGCCCCCGACTCACTAGTCAATGGCGAACCAATTGATGTAGTGAGTTAGAGGAAAAGAAAAATATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 19.90% | 13.84% | 0.13% | NA |
| All Indica | 2759 | 43.30% | 33.60% | 22.87% | 0.22% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 53.80% | 43.00% | 3.19% | 0.00% | NA |
| Indica II | 465 | 23.20% | 12.90% | 63.23% | 0.65% | NA |
| Indica III | 913 | 36.60% | 46.50% | 16.76% | 0.11% | NA |
| Indica Intermediate | 786 | 55.10% | 23.70% | 20.99% | 0.25% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 15.60% | 14.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716123713 | A -> DEL | N | N | silent_mutation | Average:25.094; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0716123713 | A -> G | LOC_Os07g27590-LOC_Os07g27610 | intergenic_region ; MODIFIER | silent_mutation | Average:25.094; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716123713 | NA | 9.13E-06 | mr1127 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716123713 | NA | 6.33E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716123713 | 9.54E-07 | NA | mr1553 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716123713 | NA | 4.28E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716123713 | NA | 4.56E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716123713 | NA | 4.53E-07 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |