Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715801688:

Variant ID: vg0715801688 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15801688
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAATCTCGAGAACGCAAGCCGCCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTTGAAACAAAA[T/C,A]
GAAAGTAAAAAGGGTGGTGATGCGCCGAGATTATATTGAACGTCTGTTAATTGATACATGGGGTTCGGGGTCTATTTATACCCGAGAATTACAAGATATG

Reverse complement sequence

CATATCTTGTAATTCTCGGGTATAAATAGACCCCGAACCCCATGTATCAATTAACAGACGTTCAATATAATCTCGGCGCATCACCACCCTTTTTACTTTC[A/G,T]
TTTTGTTTCAACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGGCGGCTTGCGTTCTCGAGATTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	11.40%	0.34%	0.06%	A: 0.15%
All Indica	2759	98.40%	1.10%	0.25%	0.11%	A: 0.18%
All Japonica	1512	66.60%	33.30%	0.07%	0.00%	A: 0.07%
Aus	269	97.00%	0.00%	2.60%	0.00%	A: 0.37%
Indica I	595	99.50%	0.20%	0.00%	0.00%	A: 0.34%
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	98.90%	0.40%	0.11%	0.33%	A: 0.22%
Indica Intermediate	786	97.60%	1.70%	0.64%	0.00%	A: 0.13%
Temperate Japonica	767	38.50%	61.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	8.70%	0.41%	0.00%	A: 0.41%
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715801688	T -> DEL	N	N	silent_mutation	Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0715801688	T -> A	LOC_Os07g27200.1	upstream_gene_variant ; 740.0bp to feature; MODIFIER	silent_mutation	Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0715801688	T -> A	LOC_Os07g27190-LOC_Os07g27200	intergenic_region ; MODIFIER	silent_mutation	Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0715801688	T -> C	LOC_Os07g27200.1	upstream_gene_variant ; 740.0bp to feature; MODIFIER	silent_mutation	Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg0715801688	T -> C	LOC_Os07g27190-LOC_Os07g27200	intergenic_region ; MODIFIER	silent_mutation	Average:30.685; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715801688	NA	3.32E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0715801688	NA	8.82E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	5.05E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	2.08E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	1.18E-10	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	2.19E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	3.29E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	9.87E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	7.80E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	2.96E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	1.25E-07	1.24E-07	mr1703	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	6.40E-11	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	6.89E-09	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	9.32E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	3.67E-09	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	3.26E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	2.94E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801688	NA	8.36E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251