Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715414736:

Variant ID: vg0715414736 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15414736
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTAAATGTAGGCATTTTTCTATTTTTTTAAAAAAACAATATAGTTGAAAATGACATCAATCTTTTTTTTTGGAAGAGCAGAAATATGTTACTCAACC[A/T]
AGCGTCAGTATGGACTAACTGAGAGATAAAATTGCAAGTATCTCCTAACAAAAAATCAGAAACAAAATCTGAACGAGCCTTATTAGCTAGCACATGGCTT

Reverse complement sequence

AAGCCATGTGCTAGCTAATAAGGCTCGTTCAGATTTTGTTTCTGATTTTTTGTTAGGAGATACTTGCAATTTTATCTCTCAGTTAGTCCATACTGACGCT[T/A]
GGTTGAGTAACATATTTCTGCTCTTCCAAAAAAAAAGATTGATGTCATTTTCAACTATATTGTTTTTTTAAAAAAATAGAAAAATGCCTACATTTAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	3.90%	29.71%	15.74%	NA
All Indica	2759	25.80%	6.60%	42.81%	24.79%	NA
All Japonica	1512	99.20%	0.00%	0.46%	0.33%	NA
Aus	269	16.40%	0.00%	69.52%	14.13%	NA
Indica I	595	32.30%	12.90%	30.42%	24.37%	NA
Indica II	465	16.60%	0.90%	51.18%	31.40%	NA
Indica III	913	20.40%	4.70%	49.84%	25.08%	NA
Indica Intermediate	786	32.70%	7.40%	39.06%	20.87%	NA
Temperate Japonica	767	99.10%	0.00%	0.52%	0.39%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.41%	NA
VI/Aromatic	96	87.50%	0.00%	8.33%	4.17%	NA
Intermediate	90	57.80%	4.40%	23.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715414736	A -> DEL	N	N	silent_mutation	Average:63.833; most accessible tissue: Callus, score: 77.436	N	N	N	N
vg0715414736	A -> T	LOC_Os07g26690.1	downstream_gene_variant ; 4935.0bp to feature; MODIFIER	silent_mutation	Average:63.833; most accessible tissue: Callus, score: 77.436	N	N	N	N
vg0715414736	A -> T	LOC_Os07g26690.2	downstream_gene_variant ; 4935.0bp to feature; MODIFIER	silent_mutation	Average:63.833; most accessible tissue: Callus, score: 77.436	N	N	N	N
vg0715414736	A -> T	LOC_Os07g26690-LOC_Os07g26700	intergenic_region ; MODIFIER	silent_mutation	Average:63.833; most accessible tissue: Callus, score: 77.436	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715414736	NA	2.09E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736	NA	2.81E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736	2.00E-06	1.99E-06	mr1151	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736	NA	4.33E-07	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736	NA	2.78E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715414736	NA	1.20E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251