Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715227955:

Variant ID: vg0715227955 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15227955
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACCTTTGTTGCCATCGGTTAAATCCAACTTATATGTATATGCAATCCCTACAAGCCGATGCAACGTCCAGATAACTTATCGGCTAGCACCCCGATAAAA[T/C]
ATTAGCATGAACCTATCGGCTTAACAAGACTTATATTATCAACAATAATCTAGTAGATCGAACCTAACCGATGCAGCACGAGATTGTATATGATAATCTA

Reverse complement sequence

TAGATTATCATATACAATCTCGTGCTGCATCGGTTAGGTTCGATCTACTAGATTATTGTTGATAATATAAGTCTTGTTAAGCCGATAGGTTCATGCTAAT[A/G]
TTTTATCGGGGTGCTAGCCGATAAGTTATCTGGACGTTGCATCGGCTTGTAGGGATTGCATATACATATAAGTTGGATTTAACCGATGGCAACAAAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	34.00%	0.91%	0.68%	NA
All Indica	2759	96.30%	3.50%	0.22%	0.00%	NA
All Japonica	1512	1.60%	93.80%	2.45%	2.12%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	98.20%	1.70%	0.17%	0.00%	NA
Indica II	465	95.90%	3.70%	0.43%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	91.90%	7.80%	0.38%	0.00%	NA
Temperate Japonica	767	2.00%	89.00%	4.82%	4.17%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715227955	T -> DEL	N	N	silent_mutation	Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715227955	T -> C	LOC_Os07g26470.1	upstream_gene_variant ; 686.0bp to feature; MODIFIER	silent_mutation	Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715227955	T -> C	LOC_Os07g26480.1	upstream_gene_variant ; 3010.0bp to feature; MODIFIER	silent_mutation	Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715227955	T -> C	LOC_Os07g26480.2	upstream_gene_variant ; 2997.0bp to feature; MODIFIER	silent_mutation	Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715227955	T -> C	LOC_Os07g26460.1	downstream_gene_variant ; 4892.0bp to feature; MODIFIER	silent_mutation	Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715227955	T -> C	LOC_Os07g26470-LOC_Os07g26480	intergenic_region ; MODIFIER	silent_mutation	Average:18.509; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715227955	NA	4.65E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.34E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	9.04E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	8.55E-06	8.55E-06	mr1205	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	2.04E-06	NA	mr1215	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	3.66E-06	3.66E-06	mr1230	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	4.46E-13	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.78E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.19E-15	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	6.98E-06	NA	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	4.41E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	9.34E-43	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	4.32E-15	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	2.49E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	2.10E-06	1.57E-74	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.68E-12	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	2.33E-06	2.33E-06	mr1643	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.90E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	5.40E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	3.82E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	2.11E-06	NA	mr1746	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	9.44E-06	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	2.74E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.27E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.41E-40	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.20E-40	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	8.18E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	9.03E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	4.77E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	3.38E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	5.97E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	1.63E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	2.21E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715227955	NA	2.61E-30	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251