Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715139529:

Variant ID: vg0715139529 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15139529
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCAATATGAGCTTAATTCGGATAGGGATCCAAATAGGAGTCCTACGGGCCTTGGAGGCCCGAGTAATGGATCCTAAATATCCATGAGGGGTGTGACCGG[C/T]
GGAGGAATTGCATCACGTGAGAAACCCTAGCCGTCACTTCCCTCCCCGAGCAAAACCGCCCGCGGGTGCTAGCACATCTGCGCGTGGCGTTCTGTCCCTG

Reverse complement sequence

CAGGGACAGAACGCCACGCGCAGATGTGCTAGCACCCGCGGGCGGTTTTGCTCGGGGAGGGAAGTGACGGCTAGGGTTTCTCACGTGATGCAATTCCTCC[G/A]
CCGGTCACACCCCTCATGGATATTTAGGATCCATTACTCGGGCCTCCAAGGCCCGTAGGACTCCTATTTGGATCCCTATCCGAATTAAGCTCATATTGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	2.90%	10.66%	25.79%	NA
All Indica	2759	46.20%	0.00%	15.84%	37.91%	NA
All Japonica	1512	86.50%	9.10%	1.85%	2.58%	NA
Aus	269	55.40%	0.00%	11.52%	33.09%	NA
Indica I	595	60.20%	0.00%	16.13%	23.70%	NA
Indica II	465	48.60%	0.00%	13.76%	37.63%	NA
Indica III	913	29.70%	0.00%	17.31%	53.01%	NA
Indica Intermediate	786	53.60%	0.00%	15.14%	31.30%	NA
Temperate Japonica	767	94.50%	0.00%	1.17%	4.30%	NA
Tropical Japonica	504	69.20%	27.00%	3.17%	0.60%	NA
Japonica Intermediate	241	97.10%	0.40%	1.24%	1.24%	NA
VI/Aromatic	96	65.60%	0.00%	2.08%	32.29%	NA
Intermediate	90	75.60%	2.20%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715139529	C -> DEL	N	N	silent_mutation	Average:13.209; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715139529	C -> T	LOC_Os07g26350.1	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:13.209; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715139529	C -> T	LOC_Os07g26340.1	downstream_gene_variant ; 1029.0bp to feature; MODIFIER	silent_mutation	Average:13.209; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0715139529	C -> T	LOC_Os07g26340-LOC_Os07g26350	intergenic_region ; MODIFIER	silent_mutation	Average:13.209; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715139529	NA	1.40E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	3.43E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	2.25E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	1.94E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	1.04E-07	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	3.97E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	4.14E-07	4.13E-07	mr1335_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	3.06E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715139529	NA	1.42E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251