Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715019955:

Variant ID: vg0715019955 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15019955
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

TCATATGTGCTTATGCCCCTCAGAGGGCCTCCTGCCCACCTTATATAGGATGGGGGGCAGGATTACAAGATAGAAACCTTAACCAATACGGTATCGGTTT[T/C]
CTAAATCTATTTTACAATATTATCAAATCAGGATTTTAGGCCGCTCCATAATATAAAAGGAAACGTAATACCCAAGTCATGATGTCACACTCCGAACTAG

Reverse complement sequence

CTAGTTCGGAGTGTGACATCATGACTTGGGTATTACGTTTCCTTTTATATTATGGAGCGGCCTAAAATCCTGATTTGATAATATTGTAAAATAGATTTAG[A/G]
AAACCGATACCGTATTGGTTAAGGTTTCTATCTTGTAATCCTGCCCCCCATCCTATATAAGGTGGGCAGGAGGCCCTCTGAGGGGCATAAGCACATATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.30%	23.20%	22.49%	21.03%	NA
All Indica	2759	2.40%	32.10%	35.48%	29.97%	NA
All Japonica	1512	93.50%	0.30%	0.66%	5.56%	NA
Aus	269	1.10%	69.10%	7.43%	22.30%	NA
Indica I	595	2.00%	29.60%	41.68%	26.72%	NA
Indica II	465	4.70%	20.40%	35.27%	39.57%	NA
Indica III	913	1.10%	33.40%	36.25%	29.24%	NA
Indica Intermediate	786	2.90%	39.40%	30.03%	27.61%	NA
Temperate Japonica	767	88.40%	0.10%	1.04%	10.43%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	97.50%	0.40%	0.83%	1.24%	NA
VI/Aromatic	96	45.80%	3.10%	42.71%	8.33%	NA
Intermediate	90	48.90%	20.00%	14.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715019955	T -> DEL	N	N	silent_mutation	Average:18.818; most accessible tissue: Callus, score: 40.07	N	N	N	N
vg0715019955	T -> C	LOC_Os07g26130.1	upstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:18.818; most accessible tissue: Callus, score: 40.07	N	N	N	N
vg0715019955	T -> C	LOC_Os07g26140.1	upstream_gene_variant ; 2815.0bp to feature; MODIFIER	silent_mutation	Average:18.818; most accessible tissue: Callus, score: 40.07	N	N	N	N
vg0715019955	T -> C	LOC_Os07g26130-LOC_Os07g26140	intergenic_region ; MODIFIER	silent_mutation	Average:18.818; most accessible tissue: Callus, score: 40.07	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715019955	NA	3.22E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715019955	2.36E-08	2.36E-08	mr1004_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715019955	NA	5.12E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251