Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714952310:

Variant ID: vg0714952310 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14952310
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTAATGCTATTTACATGAGAACGACATAATTAAAAATAATATTATATGGTTCCATATGACATTTTTAATTGTACGTATGTATATATATTTTTTCTAGT[G/A]
AATAGTAATCTCTCATACGCACTTACTTTTTTCCTTTTTTGAACAAATATTTTTCTCTCATATGGGTAGAGTATGCGTATATGTATTCATGGAGTGGGTA

Reverse complement sequence

TACCCACTCCATGAATACATATACGCATACTCTACCCATATGAGAGAAAAATATTTGTTCAAAAAAGGAAAAAAGTAAGTGCGTATGAGAGATTACTATT[C/T]
ACTAGAAAAAATATATATACATACGTACAATTAAAAATGTCATATGGAACCATATAATATTATTTTTAATTATGTCGTTCTCATGTAAATAGCATTAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	8.10%	5.27%	47.19%	NA
All Indica	2759	8.20%	12.80%	8.45%	70.53%	NA
All Japonica	1512	98.70%	0.00%	0.00%	1.26%	NA
Aus	269	5.20%	9.70%	4.46%	80.67%	NA
Indica I	595	2.70%	7.70%	10.76%	78.82%	NA
Indica II	465	5.80%	9.90%	7.31%	76.99%	NA
Indica III	913	10.70%	19.50%	7.67%	62.10%	NA
Indica Intermediate	786	10.80%	10.70%	8.27%	70.23%	NA
Temperate Japonica	767	98.30%	0.00%	0.00%	1.69%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	85.40%	1.00%	1.04%	12.50%	NA
Intermediate	90	55.60%	1.10%	3.33%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714952310	G -> DEL	N	N	silent_mutation	Average:11.603; most accessible tissue: Callus, score: 29.69	N	N	N	N
vg0714952310	G -> A	LOC_Os07g26060.1	downstream_gene_variant ; 4923.0bp to feature; MODIFIER	silent_mutation	Average:11.603; most accessible tissue: Callus, score: 29.69	N	N	N	N
vg0714952310	G -> A	LOC_Os07g26060-LOC_Os07g26070	intergenic_region ; MODIFIER	silent_mutation	Average:11.603; most accessible tissue: Callus, score: 29.69	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714952310	NA	5.27E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	1.77E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	1.28E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	6.85E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	7.16E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	2.26E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	3.44E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	4.68E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714952310	NA	1.59E-06	mr1879	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251