Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714920957:

Variant ID: vg0714920957 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14920957
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGTGTGCGCGTGTTTTATATTCAGAACCTACTAATATGCTAACCATTCTGGTTTCTGATTGGCTATATTGAGAACCTTGGTCACCATACATACACAAG[C/T]
CACTCCAGTAGTAGTGCTAGTGTGATGCCAAATTGTTCGAGGGTAGTTGTGAACCTATGAAATCTGATAATTAGCCATATATAAAATATGTATGCACAAT

Reverse complement sequence

ATTGTGCATACATATTTTATATATGGCTAATTATCAGATTTCATAGGTTCACAACTACCCTCGAACAATTTGGCATCACACTAGCACTACTACTGGAGTG[G/A]
CTTGTGTATGTATGGTGACCAAGGTTCTCAATATAGCCAATCAGAAACCAGAATGGTTAGCATATTAGTAGGTTCTGAATATAAAACACGCGCACACATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	4.00%	0.13%	3.00%	NA
All Indica	2759	94.50%	1.10%	0.07%	4.35%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	32.30%	58.40%	1.49%	7.81%	NA
Indica I	595	91.60%	0.20%	0.17%	8.07%	NA
Indica II	465	95.70%	0.00%	0.00%	4.30%	NA
Indica III	913	98.40%	0.80%	0.00%	0.88%	NA
Indica Intermediate	786	91.30%	2.90%	0.13%	5.60%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714920957	C -> DEL	N	N	silent_mutation	Average:69.606; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0714920957	C -> T	LOC_Os07g26020.1	upstream_gene_variant ; 4367.0bp to feature; MODIFIER	silent_mutation	Average:69.606; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0714920957	C -> T	LOC_Os07g26000.1	downstream_gene_variant ; 507.0bp to feature; MODIFIER	silent_mutation	Average:69.606; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0714920957	C -> T	LOC_Os07g26010.1	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:69.606; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0714920957	C -> T	LOC_Os07g26000-LOC_Os07g26010	intergenic_region ; MODIFIER	silent_mutation	Average:69.606; most accessible tissue: Callus, score: 96.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714920957	NA	5.28E-41	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	2.52E-08	NA	mr1134_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	NA	6.91E-14	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	NA	1.85E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	NA	7.09E-34	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	4.14E-07	1.18E-50	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	NA	3.31E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	6.53E-06	3.82E-31	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714920957	NA	1.12E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251