Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714511673:

Variant ID: vg0714511673 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14511673
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TAAACTAAAAGAGTTTTGTGAAATCTACTCTTCTTTATATGTACCATCGACAAACGCCCACTTCCCAAAGTGCCATCAACAAACACCTCCCTTGTACGCC[A/G]
TGAGAATCTCAAATCACGACATGACGAATGTGCCCCCCACCGCTACCAGCGTTCTAGAAACATTATGCAGGTATTACTCCAAAACAAAGCAAAGAAGCTC

Reverse complement sequence

GAGCTTCTTTGCTTTGTTTTGGAGTAATACCTGCATAATGTTTCTAGAACGCTGGTAGCGGTGGGGGGCACATTCGTCATGTCGTGATTTGAGATTCTCA[T/C]
GGCGTACAAGGGAGGTGTTTGTTGATGGCACTTTGGGAAGTGGGCGTTTGTCGATGGTACATATAAAGAAGAGTAGATTTCACAAAACTCTTTTAGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.50%	0.17%	0.00%	NA
All Indica	2759	44.00%	55.70%	0.25%	0.00%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	59.20%	40.50%	0.34%	0.00%	NA
Indica II	465	19.60%	80.20%	0.22%	0.00%	NA
Indica III	913	41.10%	58.80%	0.11%	0.00%	NA
Indica Intermediate	786	50.50%	49.10%	0.38%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714511673	A -> G	LOC_Os07g25390.1	intron_variant ; MODIFIER	silent_mutation	Average:66.446; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714511673	NA	9.93E-07	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	6.76E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	6.99E-10	mr1705	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	1.50E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	1.37E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	8.66E-07	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	5.30E-07	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714511673	NA	5.65E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251