Search for Variation information by Variation ID:
Detailed information for vg0714405504:
| Variant ID: vg0714405504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14405504 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GCAAAACGCTTGGAAATGAAGGAATGAGTTGCACCAGAGTCAAACAATATTACTGCCGGTGTCGAGTTGATAGGAAATGTGCCCAATATAACCTCTGGTG[C/T]
TGACTGCGCCTCCTCTGCATACGCATGATTGACACTTTCCAACCGTGTGTCCGGGTTTGTTACAATTGAAGCAGAGTTTGGGCTTTCCTCCAAACCTCTG
Reverse complement sequence
CAGAGGTTTGGAGGAAAGCCCAAACTCTGCTTCAATTGTAACAAACCCGGACACACGGTTGGAAAGTGTCAATCATGCGTATGCAGAGGAGGCGCAGTCA[G/A]
CACCAGAGGTTATATTGGGCACATTTCCTATCAACTCGACACCGGCAGTAATATTGTTTGACTCTGGTGCAACTCATTCCTTCATTTCCAAGCGTTTTGC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.50% | 0.60% | 2.50% | 49.37% | NA |
| All Indica | 2759 | 27.70% | 0.60% | 3.08% | 68.61% | NA |
| All Japonica | 1512 | 84.50% | 0.00% | 0.73% | 14.81% | NA |
| Aus | 269 | 24.50% | 3.70% | 5.58% | 66.17% | NA |
| Indica I | 595 | 52.80% | 1.70% | 4.03% | 41.51% | NA |
| Indica II | 465 | 32.50% | 0.20% | 2.37% | 64.95% | NA |
| Indica III | 913 | 5.50% | 0.10% | 3.18% | 91.24% | NA |
| Indica Intermediate | 786 | 31.70% | 0.60% | 2.67% | 65.01% | NA |
| Temperate Japonica | 767 | 84.90% | 0.00% | 0.65% | 14.47% | NA |
| Tropical Japonica | 504 | 93.70% | 0.00% | 0.79% | 5.56% | NA |
| Japonica Intermediate | 241 | 63.90% | 0.00% | 0.83% | 35.27% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 2.08% | 12.50% | NA |
| Intermediate | 90 | 64.40% | 1.10% | 5.56% | 28.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714405504 | C -> DEL | LOC_Os07g25210.1 | N | frameshift_variant | Average:20.779; most accessible tissue: Callus, score: 50.741 | N | N | N | N |
| vg0714405504 | C -> T | LOC_Os07g25210.1 | missense_variant ; p.Ala710Thr; MODERATE | nonsynonymous_codon ; A710T | Average:20.779; most accessible tissue: Callus, score: 50.741 | benign  |
0.573 |
DELETERIOUS | 0.02 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714405504 | NA | 7.72E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | NA | 5.75E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | NA | 5.60E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | NA | 3.74E-06 | mr1285 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | 3.81E-06 | NA | mr1418 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | 3.51E-06 | 3.51E-06 | mr1420 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | 1.74E-06 | 2.62E-06 | mr1665 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714405504 | 6.82E-06 | 6.82E-06 | mr1764 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |