Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714325094:

Variant ID: vg0714325094 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14325094
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAGTAGGCAAATTGAATTGATAAAAAATCACACTCTATTATTATGATGATAGCCCCCGACTGACAACTTCGAGGAGAAAACTTGATGTTGACAGTCAA[G/A]
ACAGGGAAGTACAATGATAAGCCTAAGCGTAGAAACGACGAAGATGTTCAATGTTCCAAGAGTTGTCGACGAGAGTACCGTCTTCGCGCTTGAGTCGATA

Reverse complement sequence

TATCGACTCAAGCGCGAAGACGGTACTCTCGTCGACAACTCTTGGAACATTGAACATCTTCGTCGTTTCTACGCTTAGGCTTATCATTGTACTTCCCTGT[C/T]
TTGACTGTCAACATCAAGTTTTCTCCTCGAAGTTGTCAGTCGGGGGCTATCATCATAATAATAGAGTGTGATTTTTTATCAATTCAATTTGCCTACTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	6.30%	38.47%	4.13%	NA
All Indica	2759	29.10%	9.50%	59.73%	1.63%	NA
All Japonica	1512	84.90%	2.20%	7.01%	5.82%	NA
Aus	269	93.70%	0.40%	4.09%	1.86%	NA
Indica I	595	42.20%	7.10%	47.39%	3.36%	NA
Indica II	465	28.60%	6.00%	62.58%	2.80%	NA
Indica III	913	16.60%	13.70%	69.55%	0.11%	NA
Indica Intermediate	786	34.10%	8.50%	55.98%	1.40%	NA
Temperate Japonica	767	82.70%	0.10%	6.26%	10.95%	NA
Tropical Japonica	504	88.90%	5.80%	4.96%	0.40%	NA
Japonica Intermediate	241	83.80%	1.70%	13.69%	0.83%	NA
VI/Aromatic	96	17.70%	1.00%	27.08%	54.17%	NA
Intermediate	90	62.20%	2.20%	30.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714325094	G -> DEL	N	N	silent_mutation	Average:7.292; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0714325094	G -> A	LOC_Os07g25080.1	downstream_gene_variant ; 293.0bp to feature; MODIFIER	silent_mutation	Average:7.292; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0714325094	G -> A	LOC_Os07g25090.1	downstream_gene_variant ; 23.0bp to feature; MODIFIER	silent_mutation	Average:7.292; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0714325094	G -> A	LOC_Os07g25080-LOC_Os07g25090	intergenic_region ; MODIFIER	silent_mutation	Average:7.292; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714325094	NA	9.21E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	7.21E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	4.84E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	1.31E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	1.69E-06	NA	mr1795_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	4.64E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	4.21E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	1.24E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714325094	NA	1.25E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251