Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713142809:

Variant ID: vg0713142809 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13142809
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGAACCGGCTCTTCCCGATTCGCGCGCTACTCGAGAAATGTAGCGGTCTTGAAGAGGCCACTCATTATTATCGGTCGTTTTTTCCTAGCCGATGCGC[A/G]
CGATTTGCGACCGCTGGGTTCCTGCCCGCCTGTAGAGACCGGTCCCACCTGTCACCAGACCTAAGGAGTGGCGTCACGCCCGAGCGCTTCCCTCGAGGGG

Reverse complement sequence

CCCCTCGAGGGAAGCGCTCGGGCGTGACGCCACTCCTTAGGTCTGGTGACAGGTGGGACCGGTCTCTACAGGCGGGCAGGAACCCAGCGGTCGCAAATCG[T/C]
GCGCATCGGCTAGGAAAAAACGACCGATAATAATGAGTGGCCTCTTCAAGACCGCTACATTTCTCGAGTAGCGCGCGAATCGGGAAGAGCCGGTTCATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 23.20% 1.54% 6.77% NA
All Indica  2759 98.90% 0.70% 0.07% 0.33% NA
All Japonica  1512 6.30% 69.30% 4.10% 20.30% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 97.20% 1.90% 0.22% 0.65% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 98.30% 1.10% 0.00% 0.51% NA
Temperate Japonica  767 6.90% 64.50% 1.56% 26.99% NA
Tropical Japonica  504 4.60% 74.40% 8.33% 12.70% NA
Japonica Intermediate  241 7.90% 73.90% 3.32% 14.94% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 58.90% 30.00% 7.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713142809 A -> DEL N N silent_mutation Average:75.725; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N
vg0713142809 A -> G LOC_Os07g23310.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:75.725; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N
vg0713142809 A -> G LOC_Os07g23300.1 downstream_gene_variant ; 4117.0bp to feature; MODIFIER silent_mutation Average:75.725; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N
vg0713142809 A -> G LOC_Os07g23320.1 downstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:75.725; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N
vg0713142809 A -> G LOC_Os07g23310-LOC_Os07g23320 intergenic_region ; MODIFIER silent_mutation Average:75.725; most accessible tissue: Minghui63 flag leaf, score: 92.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0713142809 A G 0.0 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713142809 NA 2.19E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 8.54E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 9.08E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 2.73E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 2.62E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 6.34E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 2.42E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 2.03E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 3.83E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 1.17E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 8.66E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 1.91E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 7.69E-07 NA mr1741_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 2.87E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 9.16E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 7.77E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 8.16E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713142809 NA 9.14E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251