Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712999468:

Variant ID: vg0712999468 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12999468
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGAGATAGATCTGTGCAGCCGGGTATGGTTGTTCAGGATGGTTGGGCCTGTGCAGCATGGGTGTGCTGTTCAGTGTTGATTAATATTGATGATTAATTA[C/T]
TCTACTGTTTTACAATTCTTAAATATTTTCTAAATGCTGCTTTTGCAAATGAACCCTATATTATGCCATCCTTTGGTATTCTTGTGCACTTGCATATTTG

Reverse complement sequence

CAAATATGCAAGTGCACAAGAATACCAAAGGATGGCATAATATAGGGTTCATTTGCAAAAGCAGCATTTAGAAAATATTTAAGAATTGTAAAACAGTAGA[G/A]
TAATTAATCATCAATATTAATCAACACTGAACAGCACACCCATGCTGCACAGGCCCAACCATCCTGAACAACCATACCCGGCTGCACAGATCTATCTCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	1.00%	4.25%	22.37%	NA
All Indica	2759	65.50%	0.00%	5.22%	29.32%	NA
All Japonica	1512	89.20%	3.00%	2.18%	5.62%	NA
Aus	269	56.10%	0.00%	7.43%	36.43%	NA
Indica I	595	86.20%	0.00%	3.70%	10.08%	NA
Indica II	465	65.40%	0.00%	6.88%	27.74%	NA
Indica III	913	48.80%	0.00%	5.04%	46.11%	NA
Indica Intermediate	786	69.10%	0.00%	5.60%	25.32%	NA
Temperate Japonica	767	87.00%	5.90%	3.26%	3.91%	NA
Tropical Japonica	504	91.90%	0.00%	0.60%	7.54%	NA
Japonica Intermediate	241	90.90%	0.00%	2.07%	7.05%	NA
VI/Aromatic	96	49.00%	0.00%	3.12%	47.92%	NA
Intermediate	90	76.70%	1.10%	1.11%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712999468	C -> DEL	N	N	silent_mutation	Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0712999468	C -> T	LOC_Os07g23030.1	upstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0712999468	C -> T	LOC_Os07g23030.3	upstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0712999468	C -> T	LOC_Os07g23040.1	downstream_gene_variant ; 3167.0bp to feature; MODIFIER	silent_mutation	Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0712999468	C -> T	LOC_Os07g23030-LOC_Os07g23040	intergenic_region ; MODIFIER	silent_mutation	Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712999468	NA	2.12E-09	mr1028	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468	7.50E-07	7.50E-07	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468	NA	1.33E-08	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468	NA	4.56E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468	NA	4.01E-09	mr1652	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468	NA	6.41E-07	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468	NA	9.72E-06	mr1874_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251